Incidental Mutation 'R3552:Usp39'
ID268990
Institutional Source Beutler Lab
Gene Symbol Usp39
Ensembl Gene ENSMUSG00000056305
Gene Nameubiquitin specific peptidase 39
SynonymsSAD1, CGI-21, D6Wsu157e
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72318678-72345184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72337832 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 197 (T197I)
Ref Sequence ENSEMBL: ENSMUSP00000064515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070345
AA Change: T197I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305
AA Change: T197I

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154799
Predicted Effect probably benign
Transcript: ENSMUST00000206262
Meta Mutation Damage Score 0.6424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Usp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Usp39 APN 6 72328624 missense probably damaging 0.99
IGL01065:Usp39 APN 6 72339975 missense probably damaging 1.00
IGL01669:Usp39 APN 6 72338493 missense probably damaging 0.99
IGL03089:Usp39 APN 6 72328639 missense probably damaging 1.00
IGL03397:Usp39 APN 6 72336313 missense possibly damaging 0.53
R0561:Usp39 UTSW 6 72336385 missense probably damaging 1.00
R3236:Usp39 UTSW 6 72338389 splice site probably benign
R4010:Usp39 UTSW 6 72336485 missense probably benign 0.44
R4854:Usp39 UTSW 6 72325682 missense probably benign 0.29
R5502:Usp39 UTSW 6 72328687 missense probably benign
R6868:Usp39 UTSW 6 72337751 missense possibly damaging 0.93
R6887:Usp39 UTSW 6 72333157 missense probably damaging 1.00
R7313:Usp39 UTSW 6 72336430 missense probably benign 0.00
R7429:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7430:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7431:Usp39 UTSW 6 72336268 missense possibly damaging 0.66
R7544:Usp39 UTSW 6 72342908 missense probably damaging 1.00
R7548:Usp39 UTSW 6 72345013 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTGCCTGCACTAAGAGAGC -3'
(R):5'- TCAGTGATTCAGGGTTAGACATG -3'

Sequencing Primer
(F):5'- TGCACTAAGAGAGCAGGATTCCC -3'
(R):5'- GAAACTGTAGATTGGAGGACTTACTC -3'
Posted On2015-02-19