Incidental Mutation 'R4717:Nsf'
ID 354152
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene Name N-ethylmaleimide sensitive fusion protein
Synonyms SKD2, N-ethylmaleimide sensitive factor
MMRRC Submission 041984-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4717 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 103821782-103954056 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 103823769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 728 (K728T)
Ref Sequence ENSEMBL: ENSMUSP00000099364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075]
AlphaFold P46460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040443
Predicted Effect probably damaging
Transcript: ENSMUST00000103075
AA Change: K728T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: K728T

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146036
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,221,787 L60P probably damaging Het
Acsf2 T G 11: 94,559,546 M512L probably benign Het
Ahrr T A 13: 74,215,766 H312L probably benign Het
Akr1c18 T C 13: 4,136,718 M244V probably benign Het
Aldh3b2 A G 19: 3,981,128 Y459C probably damaging Het
Arhgap29 A T 3: 122,009,958 I796L possibly damaging Het
Arrdc4 T A 7: 68,741,658 D287V probably damaging Het
Astn2 A T 4: 65,644,754 I930N possibly damaging Het
Bace2 T A 16: 97,436,873 L508Q probably damaging Het
Baz2a G T 10: 128,124,942 C1537F possibly damaging Het
Cad A G 5: 31,066,686 probably null Het
Capn5 A T 7: 98,123,919 I626N probably benign Het
Car8 A T 4: 8,169,685 N274K probably damaging Het
Casp14 T C 10: 78,715,124 I76V probably benign Het
Ccdc88c A G 12: 100,916,666 V1649A probably benign Het
Cemip A T 7: 83,947,280 I1092N probably damaging Het
Clspn A G 4: 126,560,056 N91D probably damaging Het
Cpxm2 A G 7: 132,054,845 Y563H possibly damaging Het
Csnk1g2 T C 10: 80,637,915 V72A probably benign Het
Cyp46a1 T C 12: 108,352,026 probably null Het
Cyp4x1 T C 4: 115,121,705 H206R probably benign Het
Dapk1 T A 13: 60,726,662 probably null Het
Ddx1 A G 12: 13,240,887 W76R probably damaging Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah2 T C 11: 69,429,357 D3962G probably benign Het
Dnajc14 T A 10: 128,806,244 C12S possibly damaging Het
Dock1 T C 7: 134,848,170 I804T probably damaging Het
Efs G T 14: 54,920,344 S170Y probably damaging Het
Eml4 G T 17: 83,448,225 W295C probably benign Het
Fkbp15 A G 4: 62,308,069 S748P probably damaging Het
Ghr T G 15: 3,319,753 I648L possibly damaging Het
Gigyf1 T A 5: 137,525,232 I942N probably damaging Het
Gm960 A G 19: 4,625,873 probably benign Het
Gpam T A 19: 55,075,614 E682D probably benign Het
Gsr A T 8: 33,693,858 K383* probably null Het
Hapln1 C A 13: 89,605,460 S248R probably benign Het
Haus2 G T 2: 120,619,102 R209L probably benign Het
Hhatl A G 9: 121,789,877 F63S probably damaging Het
Hmcn1 A G 1: 150,619,065 M4091T probably benign Het
Hspb7 A G 4: 141,422,585 D94G probably damaging Het
Irf6 T A 1: 193,167,434 probably null Het
Itgb2 T A 10: 77,546,044 L60* probably null Het
Jmjd1c C T 10: 67,158,051 Q104* probably null Het
Kcnh1 A G 1: 192,276,717 D193G probably damaging Het
Klhl25 G T 7: 75,866,780 C478F probably damaging Het
Klhl3 T C 13: 58,030,516 D267G probably damaging Het
L3mbtl4 T G 17: 68,455,713 H80Q probably null Het
Lhcgr C A 17: 88,742,467 V544F probably benign Het
Mfsd4a T C 1: 132,057,895 N168D probably benign Het
Mmp3 A G 9: 7,449,881 Q255R possibly damaging Het
Mrgprb3 C A 7: 48,643,252 G184C probably benign Het
Mtpap C T 18: 4,396,394 A562V possibly damaging Het
Nid1 T C 13: 13,506,501 V1072A probably benign Het
Olfr1328 T C 4: 118,934,429 N140D probably benign Het
Olfr23 T A 11: 73,940,815 S190T possibly damaging Het
Olfr448 T C 6: 42,897,224 Y258H probably damaging Het
Olfr530 T C 7: 140,373,415 N65S probably damaging Het
Olfr725 A T 14: 50,035,364 V13E probably damaging Het
Pcsk5 A T 19: 17,525,267 C894S probably damaging Het
Pde2a A G 7: 101,494,672 D166G probably benign Het
Pfpl G A 19: 12,429,254 E290K probably benign Het
Pi4kb A C 3: 94,998,851 I570L probably damaging Het
Plxnb2 A T 15: 89,157,419 C1727* probably null Het
Poln A T 5: 34,129,448 D125E possibly damaging Het
Pomgnt1 A G 4: 116,154,215 D259G possibly damaging Het
Prx A T 7: 27,516,727 M218L probably benign Het
Pxn A T 5: 115,551,942 Q342L probably damaging Het
Rhpn2 A G 7: 35,334,350 D3G possibly damaging Het
Rnase2b C T 14: 51,162,717 T85I possibly damaging Het
Rnaseh2b C A 14: 62,353,626 T142K probably damaging Het
Sacs T C 14: 61,212,855 S4117P probably damaging Het
Sdk2 T C 11: 113,854,369 N700S probably damaging Het
Sec62 A C 3: 30,809,871 K101Q unknown Het
Sel1l2 A C 2: 140,230,023 L659R possibly damaging Het
Sept11 A G 5: 93,156,956 I211V possibly damaging Het
Slc25a42 C T 8: 70,189,457 E112K probably damaging Het
Spem2 T C 11: 69,817,783 N119D probably benign Het
Themis G A 10: 28,789,752 E604K probably benign Het
Tie1 T C 4: 118,486,217 K150E probably damaging Het
Ubap2 G A 4: 41,218,333 T258I possibly damaging Het
Ushbp1 C T 8: 71,385,669 A664T probably damaging Het
Vmn1r1 T C 1: 182,157,209 N297S possibly damaging Het
Vmn1r173 A C 7: 23,703,212 I291L probably damaging Het
Yy1 A G 12: 108,794,046 I212V possibly damaging Het
Zfp442 A T 2: 150,408,229 F527L probably damaging Het
Zyg11b T A 4: 108,241,872 H632L probably damaging Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1203:Nsf UTSW 11 103926126 unclassified probably benign
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2289:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2405:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2407:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2411:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2925:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
R7155:Nsf UTSW 11 103828530 nonsense probably null
R7272:Nsf UTSW 11 103827238 missense probably damaging 1.00
R7769:Nsf UTSW 11 103928839 missense probably damaging 1.00
R8323:Nsf UTSW 11 103928839 missense probably benign 0.05
R8487:Nsf UTSW 11 103928758 missense probably damaging 1.00
R8856:Nsf UTSW 11 103930742 missense possibly damaging 0.69
R9253:Nsf UTSW 11 103913316 missense probably null 1.00
R9476:Nsf UTSW 11 103873162 missense probably damaging 1.00
R9509:Nsf UTSW 11 103863248 missense probably benign 0.19
R9510:Nsf UTSW 11 103873162 missense probably damaging 1.00
R9520:Nsf UTSW 11 103913883 missense probably damaging 1.00
R9546:Nsf UTSW 11 103910449 nonsense probably null
R9632:Nsf UTSW 11 103823768 missense probably damaging 1.00
R9779:Nsf UTSW 11 103828526 missense probably damaging 0.99
X0066:Nsf UTSW 11 103823740 missense probably benign
Z1176:Nsf UTSW 11 103910554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTGTGACAAGGAAGTC -3'
(R):5'- TGCTTCGAAACAACAACTAGGG -3'

Sequencing Primer
(F):5'- ACGACAGCCTGCTTCCTTG -3'
(R):5'- CTTCGAAACAACAACTAGGGAATGG -3'
Posted On 2015-10-21