Mutagenetix > Incidental Mutations

Incidental Mutation 'R4717:Plxnb2'

354170

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

041984-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R4717 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 89157419 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1727 (C1727*)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

probably null
Transcript: ENSMUST00000060808
AA Change: C1727*

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: C1727*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109331
AA Change: C1727*

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: C1727*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230393

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	T	C	10: 29,221,787	L60P	probably damaging	Het
Acsf2	T	G	11: 94,559,546	M512L	probably benign	Het
Ahrr	T	A	13: 74,215,766	H312L	probably benign	Het
Akr1c18	T	C	13: 4,136,718	M244V	probably benign	Het
Aldh3b2	A	G	19: 3,981,128	Y459C	probably damaging	Het
Arhgap29	A	T	3: 122,009,958	I796L	possibly damaging	Het
Arrdc4	T	A	7: 68,741,658	D287V	probably damaging	Het
Astn2	A	T	4: 65,644,754	I930N	possibly damaging	Het
Bace2	T	A	16: 97,436,873	L508Q	probably damaging	Het
Baz2a	G	T	10: 128,124,942	C1537F	possibly damaging	Het
Cad	A	G	5: 31,066,686		probably null	Het
Capn5	A	T	7: 98,123,919	I626N	probably benign	Het
Car8	A	T	4: 8,169,685	N274K	probably damaging	Het
Casp14	T	C	10: 78,715,124	I76V	probably benign	Het
Ccdc88c	A	G	12: 100,916,666	V1649A	probably benign	Het
Cemip	A	T	7: 83,947,280	I1092N	probably damaging	Het
Clspn	A	G	4: 126,560,056	N91D	probably damaging	Het
Cpxm2	A	G	7: 132,054,845	Y563H	possibly damaging	Het
Csnk1g2	T	C	10: 80,637,915	V72A	probably benign	Het
Cyp46a1	T	C	12: 108,352,026		probably null	Het
Cyp4x1	T	C	4: 115,121,705	H206R	probably benign	Het
Dapk1	T	A	13: 60,726,662		probably null	Het
Ddx1	A	G	12: 13,240,887	W76R	probably damaging	Het
Dhx29	G	A	13: 112,946,935	R508H	unknown	Het
Dnah2	T	C	11: 69,429,357	D3962G	probably benign	Het
Dnajc14	T	A	10: 128,806,244	C12S	possibly damaging	Het
Dock1	T	C	7: 134,848,170	I804T	probably damaging	Het
Efs	G	T	14: 54,920,344	S170Y	probably damaging	Het
Eml4	G	T	17: 83,448,225	W295C	probably benign	Het
Fkbp15	A	G	4: 62,308,069	S748P	probably damaging	Het
Ghr	T	G	15: 3,319,753	I648L	possibly damaging	Het
Gigyf1	T	A	5: 137,525,232	I942N	probably damaging	Het
Gm960	A	G	19: 4,625,873		probably benign	Het
Gpam	T	A	19: 55,075,614	E682D	probably benign	Het
Gsr	A	T	8: 33,693,858	K383*	probably null	Het
Hapln1	C	A	13: 89,605,460	S248R	probably benign	Het
Haus2	G	T	2: 120,619,102	R209L	probably benign	Het
Hhatl	A	G	9: 121,789,877	F63S	probably damaging	Het
Hmcn1	A	G	1: 150,619,065	M4091T	probably benign	Het
Hspb7	A	G	4: 141,422,585	D94G	probably damaging	Het
Irf6	T	A	1: 193,167,434		probably null	Het
Itgb2	T	A	10: 77,546,044	L60*	probably null	Het
Jmjd1c	C	T	10: 67,158,051	Q104*	probably null	Het
Kcnh1	A	G	1: 192,276,717	D193G	probably damaging	Het
Klhl25	G	T	7: 75,866,780	C478F	probably damaging	Het
Klhl3	T	C	13: 58,030,516	D267G	probably damaging	Het
L3mbtl4	T	G	17: 68,455,713	H80Q	probably null	Het
Lhcgr	C	A	17: 88,742,467	V544F	probably benign	Het
Mfsd4a	T	C	1: 132,057,895	N168D	probably benign	Het
Mmp3	A	G	9: 7,449,881	Q255R	possibly damaging	Het
Mrgprb3	C	A	7: 48,643,252	G184C	probably benign	Het
Mtpap	C	T	18: 4,396,394	A562V	possibly damaging	Het
Nid1	T	C	13: 13,506,501	V1072A	probably benign	Het
Nsf	T	G	11: 103,823,769	K728T	probably damaging	Het
Olfr1328	T	C	4: 118,934,429	N140D	probably benign	Het
Olfr23	T	A	11: 73,940,815	S190T	possibly damaging	Het
Olfr448	T	C	6: 42,897,224	Y258H	probably damaging	Het
Olfr530	T	C	7: 140,373,415	N65S	probably damaging	Het
Olfr725	A	T	14: 50,035,364	V13E	probably damaging	Het
Pcsk5	A	T	19: 17,525,267	C894S	probably damaging	Het
Pde2a	A	G	7: 101,494,672	D166G	probably benign	Het
Pfpl	G	A	19: 12,429,254	E290K	probably benign	Het
Pi4kb	A	C	3: 94,998,851	I570L	probably damaging	Het
Poln	A	T	5: 34,129,448	D125E	possibly damaging	Het
Pomgnt1	A	G	4: 116,154,215	D259G	possibly damaging	Het
Prx	A	T	7: 27,516,727	M218L	probably benign	Het
Pxn	A	T	5: 115,551,942	Q342L	probably damaging	Het
Rhpn2	A	G	7: 35,334,350	D3G	possibly damaging	Het
Rnase2b	C	T	14: 51,162,717	T85I	possibly damaging	Het
Rnaseh2b	C	A	14: 62,353,626	T142K	probably damaging	Het
Sacs	T	C	14: 61,212,855	S4117P	probably damaging	Het
Sdk2	T	C	11: 113,854,369	N700S	probably damaging	Het
Sec62	A	C	3: 30,809,871	K101Q	unknown	Het
Sel1l2	A	C	2: 140,230,023	L659R	possibly damaging	Het
Sept11	A	G	5: 93,156,956	I211V	possibly damaging	Het
Slc25a42	C	T	8: 70,189,457	E112K	probably damaging	Het
Spem2	T	C	11: 69,817,783	N119D	probably benign	Het
Themis	G	A	10: 28,789,752	E604K	probably benign	Het
Tie1	T	C	4: 118,486,217	K150E	probably damaging	Het
Ubap2	G	A	4: 41,218,333	T258I	possibly damaging	Het
Ushbp1	C	T	8: 71,385,669	A664T	probably damaging	Het
Vmn1r1	T	C	1: 182,157,209	N297S	possibly damaging	Het
Vmn1r173	A	C	7: 23,703,212	I291L	probably damaging	Het
Yy1	A	G	12: 108,794,046	I212V	possibly damaging	Het
Zfp442	A	T	2: 150,408,229	F527L	probably damaging	Het
Zyg11b	T	A	4: 108,241,872	H632L	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGCGGAAGACAAAAGC -3'
(R):5'- CCATATCTGGAAAACCAACAGGTG -3'

Sequencing Primer
(F):5'- AAAGCTTTTGACACTGGGCTAGC -3'
(R):5'- ACCAACAGGTGAGGCTTCTG -3'

Posted On

2015-10-21