Incidental Mutation 'R4740:Unc5c'
ID359593
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission 041965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4740 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141816931 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 706 (Y706F)
Ref Sequence ENSEMBL: ENSMUSP00000117487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably benign
Transcript: ENSMUST00000075282
AA Change: Y780F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: Y780F

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106236
AA Change: Y761F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: Y761F

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130636
AA Change: Y706F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: Y706F

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142762
AA Change: Y780F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: Y780F

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A C 1: 93,156,168 M189R probably benign Het
2510009E07Rik C T 16: 21,694,396 A4T probably benign Het
4932415D10Rik T C 10: 82,283,647 T4510A possibly damaging Het
Aacs T C 5: 125,506,252 S291P probably damaging Het
Abcb1a T C 5: 8,702,280 probably null Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Baiap2l2 T A 15: 79,259,751 Y381F probably benign Het
Chd6 A T 2: 160,970,183 D1363E probably benign Het
Cir1 T C 2: 73,312,523 probably benign Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Clec4d T A 6: 123,268,113 H117Q probably damaging Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Coro6 A G 11: 77,469,199 E362G possibly damaging Het
Ctr9 T A 7: 111,035,371 C196S probably benign Het
Cyp2c55 A G 19: 39,018,729 K190E probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dnah11 A G 12: 118,120,544 F1242L probably benign Het
Dnah2 A G 11: 69,458,042 W2534R probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Dpp9 A C 17: 56,198,970 probably null Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Eml4 T G 17: 83,410,030 D10E probably damaging Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Epn1 A G 7: 5,090,013 D108G probably damaging Het
Eps15 A G 4: 109,343,190 Y2C probably damaging Het
Fam135b C T 15: 71,464,071 V425I probably benign Het
Frem2 G A 3: 53,535,819 A2508V probably benign Het
Fzd3 T A 14: 65,235,744 M192L possibly damaging Het
Gls C T 1: 52,232,788 A69T probably damaging Het
Gm10051 T A 5: 133,475,274 noncoding transcript Het
Gm4759 G A 7: 106,423,575 noncoding transcript Het
Gm8909 T A 17: 36,167,556 I195F probably damaging Het
Gm9271 A G 7: 39,363,922 noncoding transcript Het
Gramd1b T C 9: 40,315,832 probably null Het
H2-T23 A T 17: 36,032,124 probably benign Het
Hmbox1 G A 14: 64,897,034 T39I probably damaging Het
Hmx1 A G 5: 35,391,771 E136G probably damaging Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A G 8: 110,446,439 N918S probably benign Het
Igkv5-37 T A 6: 69,963,322 S113C probably damaging Het
Il1f5 T C 2: 24,277,491 probably benign Het
Marco G T 1: 120,494,770 T61K probably damaging Het
Med1 T A 11: 98,180,264 R86* probably null Het
Mertk A G 2: 128,751,994 Y306C probably damaging Het
Mgat4c T C 10: 102,388,404 F160L probably damaging Het
Midn A T 10: 80,151,404 E88V probably null Het
Muc4 G A 16: 32,775,903 R3163H possibly damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nhlrc4 T C 17: 25,943,603 T57A probably benign Het
Nlrp1a T C 11: 71,113,640 probably null Het
Npffr2 A T 5: 89,583,020 K270* probably null Het
Olfr1090 C T 2: 86,753,811 C309Y probably benign Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr518 T G 7: 108,881,482 E41D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr943 T A 9: 39,184,368 Y60* probably null Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pabpc4l C G 3: 46,446,135 G358A possibly damaging Het
Pabpc4l C T 3: 46,446,144 R355H probably benign Het
Parp1 T C 1: 180,589,468 S606P probably damaging Het
Pkhd1 A G 1: 20,524,130 V1253A probably benign Het
Psg29 G A 7: 17,208,533 R153H probably benign Het
Rbm25 A G 12: 83,644,407 M58V possibly damaging Het
Rbm28 T C 6: 29,125,354 probably benign Het
Ryr2 A G 13: 11,657,047 S3436P possibly damaging Het
Slc3a1 A G 17: 85,046,753 I335V probably benign Het
Slc4a4 T C 5: 89,225,894 F953S probably damaging Het
Spata20 A G 11: 94,484,578 I130T possibly damaging Het
Srcap T C 7: 127,549,299 S1879P probably damaging Het
St18 G C 1: 6,817,604 V466L probably benign Het
Stard3nl A T 13: 19,367,778 M166K probably benign Het
Stard3nl G A 13: 19,376,566 T13M probably damaging Het
Stil A G 4: 115,006,782 T74A probably benign Het
Syt6 T G 3: 103,625,656 M367R probably damaging Het
Tacc1 T C 8: 25,182,565 T125A possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tcaf1 A G 6: 42,686,875 S24P probably benign Het
Trim75 T G 8: 64,982,547 Y417S probably damaging Het
Ttll12 T C 15: 83,580,120 Y503C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Zfp593 T C 4: 134,244,766 probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7956:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7979:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R8041:Unc5c UTSW 3 141465784 missense not run
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense not run
Predicted Primers PCR Primer
(F):5'- GGTCTGATGTAAATTAGGCAGGTC -3'
(R):5'- GATGCACTTGAGGCTGTTCC -3'

Sequencing Primer
(F):5'- GGCAGGTCAATCAATAATATACCTTG -3'
(R):5'- TTGGCAATGTCCCCAAAG -3'
Posted On2015-11-11