Incidental Mutation 'R4740:Chd6'
ID359587
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission 041965-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R4740 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 160970183 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1363 (D1363E)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably benign
Transcript: ENSMUST00000039782
AA Change: D1363E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: D1363E

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A C 1: 93,156,168 M189R probably benign Het
2510009E07Rik C T 16: 21,694,396 A4T probably benign Het
4932415D10Rik T C 10: 82,283,647 T4510A possibly damaging Het
Aacs T C 5: 125,506,252 S291P probably damaging Het
Abcb1a T C 5: 8,702,280 probably null Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Baiap2l2 T A 15: 79,259,751 Y381F probably benign Het
Cir1 T C 2: 73,312,523 probably benign Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Clec4d T A 6: 123,268,113 H117Q probably damaging Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Coro6 A G 11: 77,469,199 E362G possibly damaging Het
Ctr9 T A 7: 111,035,371 C196S probably benign Het
Cyp2c55 A G 19: 39,018,729 K190E probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dnah11 A G 12: 118,120,544 F1242L probably benign Het
Dnah2 A G 11: 69,458,042 W2534R probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Dpp9 A C 17: 56,198,970 probably null Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Eml4 T G 17: 83,410,030 D10E probably damaging Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Epn1 A G 7: 5,090,013 D108G probably damaging Het
Eps15 A G 4: 109,343,190 Y2C probably damaging Het
Fam135b C T 15: 71,464,071 V425I probably benign Het
Frem2 G A 3: 53,535,819 A2508V probably benign Het
Fzd3 T A 14: 65,235,744 M192L possibly damaging Het
Gls C T 1: 52,232,788 A69T probably damaging Het
Gm10051 T A 5: 133,475,274 noncoding transcript Het
Gm4759 G A 7: 106,423,575 noncoding transcript Het
Gm8909 T A 17: 36,167,556 I195F probably damaging Het
Gm9271 A G 7: 39,363,922 noncoding transcript Het
Gramd1b T C 9: 40,315,832 probably null Het
H2-T23 A T 17: 36,032,124 probably benign Het
Hmbox1 G A 14: 64,897,034 T39I probably damaging Het
Hmx1 A G 5: 35,391,771 E136G probably damaging Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A G 8: 110,446,439 N918S probably benign Het
Igkv5-37 T A 6: 69,963,322 S113C probably damaging Het
Il1f5 T C 2: 24,277,491 probably benign Het
Marco G T 1: 120,494,770 T61K probably damaging Het
Med1 T A 11: 98,180,264 R86* probably null Het
Mertk A G 2: 128,751,994 Y306C probably damaging Het
Mgat4c T C 10: 102,388,404 F160L probably damaging Het
Midn A T 10: 80,151,404 E88V probably null Het
Muc4 G A 16: 32,775,903 R3163H possibly damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nhlrc4 T C 17: 25,943,603 T57A probably benign Het
Nlrp1a T C 11: 71,113,640 probably null Het
Npffr2 A T 5: 89,583,020 K270* probably null Het
Olfr1090 C T 2: 86,753,811 C309Y probably benign Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr518 T G 7: 108,881,482 E41D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr943 T A 9: 39,184,368 Y60* probably null Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pabpc4l C G 3: 46,446,135 G358A possibly damaging Het
Pabpc4l C T 3: 46,446,144 R355H probably benign Het
Parp1 T C 1: 180,589,468 S606P probably damaging Het
Pkhd1 A G 1: 20,524,130 V1253A probably benign Het
Psg29 G A 7: 17,208,533 R153H probably benign Het
Rbm25 A G 12: 83,644,407 M58V possibly damaging Het
Rbm28 T C 6: 29,125,354 probably benign Het
Ryr2 A G 13: 11,657,047 S3436P possibly damaging Het
Slc3a1 A G 17: 85,046,753 I335V probably benign Het
Slc4a4 T C 5: 89,225,894 F953S probably damaging Het
Spata20 A G 11: 94,484,578 I130T possibly damaging Het
Srcap T C 7: 127,549,299 S1879P probably damaging Het
St18 G C 1: 6,817,604 V466L probably benign Het
Stard3nl A T 13: 19,367,778 M166K probably benign Het
Stard3nl G A 13: 19,376,566 T13M probably damaging Het
Stil A G 4: 115,006,782 T74A probably benign Het
Syt6 T G 3: 103,625,656 M367R probably damaging Het
Tacc1 T C 8: 25,182,565 T125A possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tcaf1 A G 6: 42,686,875 S24P probably benign Het
Trim75 T G 8: 64,982,547 Y417S probably damaging Het
Ttll12 T C 15: 83,580,120 Y503C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Zfp593 T C 4: 134,244,766 probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGTCACTCTAGGGAAGC -3'
(R):5'- TAACCTGATTCTCTGTGGGAAG -3'

Sequencing Primer
(F):5'- CACTCTAGGGAAGCTTAATACAGGTC -3'
(R):5'- CCTGATTCTCTGTGGGAAGAAGCTC -3'
Posted On2015-11-11