Mutagenetix > Incidental Mutations

Incidental Mutation 'R4740:Chd6'

359587

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

041965-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.765) question?

Stock #

R4740 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 160970183 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1363 (D1363E)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

Predicted Effect

probably benign
Transcript: ENSMUST00000039782
AA Change: D1363E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: D1363E

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Meta Mutation Damage Score

0.0693

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (95/95)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	C	1: 93,156,168	M189R	probably benign	Het
2510009E07Rik	C	T	16: 21,694,396	A4T	probably benign	Het
4932415D10Rik	T	C	10: 82,283,647	T4510A	possibly damaging	Het
Aacs	T	C	5: 125,506,252	S291P	probably damaging	Het
Abcb1a	T	C	5: 8,702,280		probably null	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Arhgap5	A	T	12: 52,519,077	M944L	probably benign	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Baiap2l2	T	A	15: 79,259,751	Y381F	probably benign	Het
Cir1	T	C	2: 73,312,523		probably benign	Het
Clec4a2	T	C	6: 123,140,663	I180T	probably damaging	Het
Clec4d	T	A	6: 123,268,113	H117Q	probably damaging	Het
Cntnap2	A	T	6: 45,060,317	R10W	possibly damaging	Het
Coro6	A	G	11: 77,469,199	E362G	possibly damaging	Het
Ctr9	T	A	7: 111,035,371	C196S	probably benign	Het
Cyp2c55	A	G	19: 39,018,729	K190E	probably benign	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Dnah11	A	G	12: 118,120,544	F1242L	probably benign	Het
Dnah2	A	G	11: 69,458,042	W2534R	probably damaging	Het
Dph7	T	C	2: 24,963,131	S86P	possibly damaging	Het
Dpp9	A	C	17: 56,198,970		probably null	Het
Eif4g3	T	A	4: 138,198,097	S1584T	probably benign	Het
Eml4	T	G	17: 83,410,030	D10E	probably damaging	Het
Enpp1	A	T	10: 24,679,248	C67S	probably null	Het
Epn1	A	G	7: 5,090,013	D108G	probably damaging	Het
Eps15	A	G	4: 109,343,190	Y2C	probably damaging	Het
Fam135b	C	T	15: 71,464,071	V425I	probably benign	Het
Frem2	G	A	3: 53,535,819	A2508V	probably benign	Het
Fzd3	T	A	14: 65,235,744	M192L	possibly damaging	Het
Gls	C	T	1: 52,232,788	A69T	probably damaging	Het
Gm10051	T	A	5: 133,475,274		noncoding transcript	Het
Gm4759	G	A	7: 106,423,575		noncoding transcript	Het
Gm8909	T	A	17: 36,167,556	I195F	probably damaging	Het
Gm9271	A	G	7: 39,363,922		noncoding transcript	Het
Gramd1b	T	C	9: 40,315,832		probably null	Het
H2-T23	A	T	17: 36,032,124		probably benign	Het
Hmbox1	G	A	14: 64,897,034	T39I	probably damaging	Het
Hmx1	A	G	5: 35,391,771	E136G	probably damaging	Het
Hpdl	T	C	4: 116,821,024	N80S	probably damaging	Het
Hydin	A	G	8: 110,446,439	N918S	probably benign	Het
Igkv5-37	T	A	6: 69,963,322	S113C	probably damaging	Het
Il1f5	T	C	2: 24,277,491		probably benign	Het
Marco	G	T	1: 120,494,770	T61K	probably damaging	Het
Med1	T	A	11: 98,180,264	R86*	probably null	Het
Mertk	A	G	2: 128,751,994	Y306C	probably damaging	Het
Mgat4c	T	C	10: 102,388,404	F160L	probably damaging	Het
Midn	A	T	10: 80,151,404	E88V	probably null	Het
Muc4	G	A	16: 32,775,903	R3163H	possibly damaging	Het
Naip1	T	C	13: 100,444,526	D71G	possibly damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nhlrc4	T	C	17: 25,943,603	T57A	probably benign	Het
Nlrp1a	T	C	11: 71,113,640		probably null	Het
Npffr2	A	T	5: 89,583,020	K270*	probably null	Het
Olfr1090	C	T	2: 86,753,811	C309Y	probably benign	Het
Olfr11	T	A	13: 21,639,170	M118L	possibly damaging	Het
Olfr518	T	G	7: 108,881,482	E41D	probably benign	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Olfr943	T	A	9: 39,184,368	Y60*	probably null	Het
Otub2	T	A	12: 103,392,844	L64Q	probably benign	Het
Pabpc4l	C	G	3: 46,446,135	G358A	possibly damaging	Het
Pabpc4l	C	T	3: 46,446,144	R355H	probably benign	Het
Parp1	T	C	1: 180,589,468	S606P	probably damaging	Het
Pkhd1	A	G	1: 20,524,130	V1253A	probably benign	Het
Psg29	G	A	7: 17,208,533	R153H	probably benign	Het
Rbm25	A	G	12: 83,644,407	M58V	possibly damaging	Het
Rbm28	T	C	6: 29,125,354		probably benign	Het
Ryr2	A	G	13: 11,657,047	S3436P	possibly damaging	Het
Slc3a1	A	G	17: 85,046,753	I335V	probably benign	Het
Slc4a4	T	C	5: 89,225,894	F953S	probably damaging	Het
Spata20	A	G	11: 94,484,578	I130T	possibly damaging	Het
Srcap	T	C	7: 127,549,299	S1879P	probably damaging	Het
St18	G	C	1: 6,817,604	V466L	probably benign	Het
Stard3nl	A	T	13: 19,367,778	M166K	probably benign	Het
Stard3nl	G	A	13: 19,376,566	T13M	probably damaging	Het
Stil	A	G	4: 115,006,782	T74A	probably benign	Het
Syt6	T	G	3: 103,625,656	M367R	probably damaging	Het
Tacc1	T	C	8: 25,182,565	T125A	possibly damaging	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tcaf1	A	G	6: 42,686,875	S24P	probably benign	Het
Trim75	T	G	8: 64,982,547	Y417S	probably damaging	Het
Ttll12	T	C	15: 83,580,120	Y503C	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Unc5c	A	T	3: 141,816,931	Y706F	probably benign	Het
Zfp593	T	C	4: 134,244,766		probably benign	Het
Zfp956	T	C	6: 47,962,542	S175P	probably damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTGTCACTCTAGGGAAGC -3'
(R):5'- TAACCTGATTCTCTGTGGGAAG -3'

Sequencing Primer
(F):5'- CACTCTAGGGAAGCTTAATACAGGTC -3'
(R):5'- CCTGATTCTCTGTGGGAAGAAGCTC -3'

Posted On

2015-11-11