Incidental Mutation 'R4740:Frem2'
ID 359590
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene Name Fras1 related extracellular matrix protein 2
Synonyms my, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 041965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4740 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 53513938-53657355 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53535819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 2508 (A2508V)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000091137
AA Change: A2508V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: A2508V

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197519
Meta Mutation Damage Score 0.1243 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A C 1: 93,156,168 M189R probably benign Het
2510009E07Rik C T 16: 21,694,396 A4T probably benign Het
4932415D10Rik T C 10: 82,283,647 T4510A possibly damaging Het
Aacs T C 5: 125,506,252 S291P probably damaging Het
Abcb1a T C 5: 8,702,280 probably null Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Baiap2l2 T A 15: 79,259,751 Y381F probably benign Het
Chd6 A T 2: 160,970,183 D1363E probably benign Het
Cir1 T C 2: 73,312,523 probably benign Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Clec4d T A 6: 123,268,113 H117Q probably damaging Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Coro6 A G 11: 77,469,199 E362G possibly damaging Het
Ctr9 T A 7: 111,035,371 C196S probably benign Het
Cyp2c55 A G 19: 39,018,729 K190E probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dnah11 A G 12: 118,120,544 F1242L probably benign Het
Dnah2 A G 11: 69,458,042 W2534R probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Dpp9 A C 17: 56,198,970 probably null Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Eml4 T G 17: 83,410,030 D10E probably damaging Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Epn1 A G 7: 5,090,013 D108G probably damaging Het
Eps15 A G 4: 109,343,190 Y2C probably damaging Het
Fam135b C T 15: 71,464,071 V425I probably benign Het
Fzd3 T A 14: 65,235,744 M192L possibly damaging Het
Gls C T 1: 52,232,788 A69T probably damaging Het
Gm10051 T A 5: 133,475,274 noncoding transcript Het
Gm4759 G A 7: 106,423,575 noncoding transcript Het
Gm8909 T A 17: 36,167,556 I195F probably damaging Het
Gm9271 A G 7: 39,363,922 noncoding transcript Het
Gramd1b T C 9: 40,315,832 probably null Het
H2-T23 A T 17: 36,032,124 probably benign Het
Hmbox1 G A 14: 64,897,034 T39I probably damaging Het
Hmx1 A G 5: 35,391,771 E136G probably damaging Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A G 8: 110,446,439 N918S probably benign Het
Igkv5-37 T A 6: 69,963,322 S113C probably damaging Het
Il1f5 T C 2: 24,277,491 probably benign Het
Marco G T 1: 120,494,770 T61K probably damaging Het
Med1 T A 11: 98,180,264 R86* probably null Het
Mertk A G 2: 128,751,994 Y306C probably damaging Het
Mgat4c T C 10: 102,388,404 F160L probably damaging Het
Midn A T 10: 80,151,404 E88V probably null Het
Muc4 G A 16: 32,775,903 R3163H possibly damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nhlrc4 T C 17: 25,943,603 T57A probably benign Het
Nlrp1a T C 11: 71,113,640 probably null Het
Npffr2 A T 5: 89,583,020 K270* probably null Het
Olfr1090 C T 2: 86,753,811 C309Y probably benign Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr518 T G 7: 108,881,482 E41D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr943 T A 9: 39,184,368 Y60* probably null Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pabpc4l C G 3: 46,446,135 G358A possibly damaging Het
Pabpc4l C T 3: 46,446,144 R355H probably benign Het
Parp1 T C 1: 180,589,468 S606P probably damaging Het
Pkhd1 A G 1: 20,524,130 V1253A probably benign Het
Psg29 G A 7: 17,208,533 R153H probably benign Het
Rbm25 A G 12: 83,644,407 M58V possibly damaging Het
Rbm28 T C 6: 29,125,354 probably benign Het
Ryr2 A G 13: 11,657,047 S3436P possibly damaging Het
Slc3a1 A G 17: 85,046,753 I335V probably benign Het
Slc4a4 T C 5: 89,225,894 F953S probably damaging Het
Spata20 A G 11: 94,484,578 I130T possibly damaging Het
Srcap T C 7: 127,549,299 S1879P probably damaging Het
St18 G C 1: 6,817,604 V466L probably benign Het
Stard3nl A T 13: 19,367,778 M166K probably benign Het
Stard3nl G A 13: 19,376,566 T13M probably damaging Het
Stil A G 4: 115,006,782 T74A probably benign Het
Syt6 T G 3: 103,625,656 M367R probably damaging Het
Tacc1 T C 8: 25,182,565 T125A possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tcaf1 A G 6: 42,686,875 S24P probably benign Het
Trim75 T G 8: 64,982,547 Y417S probably damaging Het
Ttll12 T C 15: 83,580,120 Y503C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Zfp593 T C 4: 134,244,766 probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7455:Frem2 UTSW 3 53572280 splice site probably null
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
R7636:Frem2 UTSW 3 53653247 missense probably benign 0.00
R7703:Frem2 UTSW 3 53522168 missense probably benign 0.01
R7750:Frem2 UTSW 3 53523682 missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R7922:Frem2 UTSW 3 53653304 missense probably damaging 0.98
R8008:Frem2 UTSW 3 53652910 missense probably damaging 1.00
R8051:Frem2 UTSW 3 53535355 missense probably benign 0.04
R8052:Frem2 UTSW 3 53549643 missense probably benign 0.02
R8176:Frem2 UTSW 3 53655340 missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53656507 nonsense probably null
R8397:Frem2 UTSW 3 53653141 missense probably benign 0.00
R8410:Frem2 UTSW 3 53539177 missense possibly damaging 0.60
R8697:Frem2 UTSW 3 53525828 missense probably damaging 0.99
R9134:Frem2 UTSW 3 53654900 missense probably damaging 1.00
R9183:Frem2 UTSW 3 53520065 missense probably damaging 1.00
R9260:Frem2 UTSW 3 53652783 missense probably damaging 1.00
R9267:Frem2 UTSW 3 53657083 start codon destroyed probably null 0.00
R9299:Frem2 UTSW 3 53656559 missense probably benign 0.37
R9378:Frem2 UTSW 3 53651989 missense probably damaging 0.99
R9444:Frem2 UTSW 3 53652844 missense probably benign 0.10
R9459:Frem2 UTSW 3 53653486 missense probably benign
R9487:Frem2 UTSW 3 53653484 missense possibly damaging 0.95
Z1177:Frem2 UTSW 3 53535166 missense probably null 1.00
Z1177:Frem2 UTSW 3 53655607 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCAACCTGCAGACTGAAGATG -3'
(R):5'- ACAAGCCTGTTGGAGAGGTTC -3'

Sequencing Primer
(F):5'- CCTGCAGACTGAAGATGAAGGAG -3'
(R):5'- AGAGGTTCCTCCCCTGTG -3'
Posted On 2015-11-11