Mutagenetix > Incidental Mutations

Incidental Mutation 'R0904:Unc5c'

83239

Institutional Source

Beutler Lab

Gene Symbol

Unc5c

Ensembl Gene

ENSMUSG00000059921

Gene Name

unc-5 netrin receptor C

Synonyms

B130051O18Rik, Unc5h3

MMRRC Submission

039062-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141465216-141834924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141803840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 620 (T620A)

Ref Sequence

ENSEMBL: ENSMUSP00000117487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]

AlphaFold

O08747

Predicted Effect

probably benign
Transcript: ENSMUST00000075282
AA Change: T694A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: T694A

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	396	418	N/A	INTRINSIC
ZU5	547	650	6.92e-63	SMART
low complexity region	695	704	N/A	INTRINSIC
DEATH	857	948	6.68e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106236
AA Change: T675A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: T675A

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	377	399	N/A	INTRINSIC
ZU5	528	631	6.92e-63	SMART
low complexity region	676	685	N/A	INTRINSIC
DEATH	838	929	6.68e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130636
AA Change: T620A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: T620A

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
IGc2	105	172	2.72e-5	SMART
TSP1	189	240	8.54e-13	SMART
TSP1	245	294	1.18e-6	SMART
transmembrane domain	322	344	N/A	INTRINSIC
ZU5	473	576	6.92e-63	SMART
low complexity region	621	630	N/A	INTRINSIC
DEATH	783	874	6.68e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142762
AA Change: T694A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: T694A

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	396	418	N/A	INTRINSIC
ZU5	547	650	6.92e-63	SMART
low complexity region	695	704	N/A	INTRINSIC
DEATH	857	948	6.68e-24	SMART

Meta Mutation Damage Score

0.0607

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.2%
20x: 94.7%

Validation Efficiency

89% (34/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	G	8: 79,248,489		probably benign	Het
2810474O19Rik	G	A	6: 149,328,269	A938T	probably damaging	Het
9230110F15Rik	T	C	9: 35,839,070	D102G	probably damaging	Het
Abca13	T	C	11: 9,298,740	V2829A	probably benign	Het
Adk	G	T	14: 21,092,428	D26Y	probably damaging	Het
Bpifb9a	T	C	2: 154,264,225		probably benign	Het
Dap	G	A	15: 31,272,380		probably benign	Het
Eqtn	A	T	4: 94,907,655	S270T	probably benign	Het
Fam193a	A	G	5: 34,462,143	D764G	probably damaging	Het
Fbxl6	A	T	15: 76,537,083		probably null	Het
Gm13212	T	C	4: 145,622,175	Y61H	possibly damaging	Het
Gm3259	A	C	5: 95,341,327	T210P	probably damaging	Het
Gtf3c1	A	T	7: 125,668,842		probably benign	Het
H2-D1	G	C	17: 35,263,861	M122I	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map1s	C	A	8: 70,914,188	P579Q	probably damaging	Het
Mapk10	A	G	5: 102,987,280		probably benign	Het
Mllt6	C	G	11: 97,664,998	C51W	probably damaging	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Neurod2	G	T	11: 98,327,321	T339K	probably benign	Het
Nfya	G	A	17: 48,395,787	Q29*	probably null	Het
Nipbl	A	T	15: 8,361,718	D257E	probably benign	Het
Pex5	G	A	6: 124,399,937		probably benign	Het
Prx	T	A	7: 27,518,294	F879Y	probably damaging	Het
Scai	G	A	2: 39,075,152	T560M	possibly damaging	Het
Slfn10-ps	T	C	11: 83,035,409		noncoding transcript	Het
Spdye4b	A	G	5: 143,195,668		probably benign	Het
Ss18l1	A	G	2: 180,059,354	Y287C	probably damaging	Het
Tpbg	C	A	9: 85,844,564	F195L	unknown	Het
Trbv16	T	C	6: 41,151,847		probably benign	Het
Vangl1	A	G	3: 102,183,994	S259P	probably damaging	Het
Vmn1r52	T	A	6: 90,179,464	M71K	probably damaging	Het
Vmn2r23	A	T	6: 123,742,135	I816F	probably damaging	Het

Other mutations in Unc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Unc5c	APN	3	141788940	missense	probably damaging	0.99
IGL01089:Unc5c	APN	3	141818202	splice site	probably benign
IGL01478:Unc5c	APN	3	141828451	missense	probably damaging	1.00
IGL02083:Unc5c	APN	3	141714647	missense	probably damaging	0.99
IGL02269:Unc5c	APN	3	141788982	missense	probably damaging	1.00
IGL02565:Unc5c	APN	3	141803919	missense	probably damaging	1.00
IGL02973:Unc5c	APN	3	141788890	missense	probably benign	0.12
R0179:Unc5c	UTSW	3	141818067	nonsense	probably null
R0309:Unc5c	UTSW	3	141733933	missense	probably benign	0.01
R0371:Unc5c	UTSW	3	141827522	missense	probably benign	0.01
R0603:Unc5c	UTSW	3	141771102	missense	probably damaging	1.00
R0907:Unc5c	UTSW	3	141789033	missense	probably damaging	0.99
R1300:Unc5c	UTSW	3	141828543	missense	possibly damaging	0.94
R1491:Unc5c	UTSW	3	141789822	missense	probably damaging	1.00
R1494:Unc5c	UTSW	3	141827549	missense	possibly damaging	0.93
R1674:Unc5c	UTSW	3	141757837	missense	possibly damaging	0.74
R1676:Unc5c	UTSW	3	141757837	missense	possibly damaging	0.74
R1726:Unc5c	UTSW	3	141818103	missense	probably damaging	1.00
R1750:Unc5c	UTSW	3	141827517	missense	possibly damaging	0.89
R1815:Unc5c	UTSW	3	141757757	missense	probably damaging	1.00
R2381:Unc5c	UTSW	3	141678155	missense	probably damaging	1.00
R2394:Unc5c	UTSW	3	141678131	missense	probably damaging	1.00
R2945:Unc5c	UTSW	3	141789974	missense	probably damaging	0.97
R4284:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4285:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4287:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4681:Unc5c	UTSW	3	141768613	critical splice donor site	probably null
R4736:Unc5c	UTSW	3	141816931	missense	probably benign	0.00
R4740:Unc5c	UTSW	3	141816931	missense	probably benign	0.00
R4774:Unc5c	UTSW	3	141828517	missense	probably damaging	1.00
R4862:Unc5c	UTSW	3	141789773	missense	probably damaging	1.00
R4905:Unc5c	UTSW	3	141801310	missense	probably benign	0.19
R4921:Unc5c	UTSW	3	141788966	missense	probably damaging	1.00
R5150:Unc5c	UTSW	3	141757793	missense	probably damaging	1.00
R5559:Unc5c	UTSW	3	141803787	missense	probably damaging	1.00
R5562:Unc5c	UTSW	3	141768530	missense	probably damaging	1.00
R5643:Unc5c	UTSW	3	141678125	missense	probably damaging	1.00
R5644:Unc5c	UTSW	3	141678125	missense	probably damaging	1.00
R5775:Unc5c	UTSW	3	141828520	missense	probably damaging	1.00
R5912:Unc5c	UTSW	3	141789006	missense	probably damaging	1.00
R6154:Unc5c	UTSW	3	141678153	missense	probably damaging	0.97
R6547:Unc5c	UTSW	3	141790019	missense	probably benign	0.16
R6558:Unc5c	UTSW	3	141789729	missense	probably damaging	0.98
R7104:Unc5c	UTSW	3	141733904	missense	probably damaging	1.00
R7113:Unc5c	UTSW	3	141801293	missense	probably benign	0.00
R7282:Unc5c	UTSW	3	141677990	missense	probably damaging	0.98
R7317:Unc5c	UTSW	3	141789942	missense	probably benign	0.00
R7787:Unc5c	UTSW	3	141768552	missense	probably damaging	1.00
R7873:Unc5c	UTSW	3	141827549	missense	probably benign	0.04
R7896:Unc5c	UTSW	3	141771161	missense	possibly damaging	0.73
R7936:Unc5c	UTSW	3	141828477	missense	possibly damaging	0.48
R8041:Unc5c	UTSW	3	141465784	missense	possibly damaging	0.92
R8277:Unc5c	UTSW	3	141768612	critical splice donor site	probably null
R8669:Unc5c	UTSW	3	141803943	missense	possibly damaging	0.91
R8886:Unc5c	UTSW	3	141803820	missense	probably benign	0.02
R8989:Unc5c	UTSW	3	141803706	splice site	probably benign
R9244:Unc5c	UTSW	3	141827609	missense	probably benign	0.00
X0018:Unc5c	UTSW	3	141714739	missense	probably damaging	1.00
X0065:Unc5c	UTSW	3	141827661	missense	probably damaging	1.00
Z1088:Unc5c	UTSW	3	141733900	missense	probably damaging	1.00
Z1176:Unc5c	UTSW	3	141678010	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATCACCTGCGGAGTTTCTGAGAG -3'
(R):5'- GGTCAGTCCAAACCTTAGCTTCCAG -3'

Sequencing Primer
(F):5'- GGCTTTTCATGTAGATTCCAGGATAC -3'
(R):5'- CCTTAGCTTCCAGGTAAGGGTG -3'

Posted On

2013-11-08