Mutagenetix > Incidental Mutation

Incidental Mutation 'R0378:Bub1b'

36455

Institutional Source

Beutler Lab

Gene Symbol

Bub1b

Ensembl Gene

ENSMUSG00000040084

Gene Name

BUB1B, mitotic checkpoint serine/threonine kinase

Synonyms

BUBR1

MMRRC Submission

038584-MU

Accession Numbers

NM_009773; MGI: 1333889

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0378 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118598211-118641591 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118641123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 988 (V988E)

Ref Sequence

ENSEMBL: ENSMUSP00000037126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038341]

AlphaFold

Q9Z1S0

Predicted Effect

probably benign
Transcript: ENSMUST00000038341
AA Change: V988E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084
AA Change: V988E

Domain	Start	End	E-Value	Type
PDB:4GGD\|D	14	35	6e-6	PDB
Mad3_BUB1_I	49	173	1.83e-68	SMART
low complexity region	198	214	N/A	INTRINSIC
low complexity region	382	395	N/A	INTRINSIC
coiled coil region	418	457	N/A	INTRINSIC
low complexity region	671	686	N/A	INTRINSIC
low complexity region	717	726	N/A	INTRINSIC
Pfam:Pkinase	806	942	4.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126013

Meta Mutation Damage Score

0.0631

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.0%
20x: 94.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	C	A	8: 113,743,117	R651L	probably damaging	Het
Amd1	T	C	10: 40,289,384	D317G	possibly damaging	Het
Artn	A	G	4: 117,927,618		probably benign	Het
Asna1	A	T	8: 85,025,264	M1K	probably null	Het
Cyp2c65	G	T	19: 39,073,218	C216F	probably benign	Het
Cyp3a11	T	C	5: 145,868,607	E200G	probably benign	Het
Cyp3a25	T	A	5: 145,986,842	K330N	probably damaging	Het
Duox2	C	A	2: 122,284,583	V1138L	probably benign	Het
Erc2	A	G	14: 28,011,694	D567G	probably damaging	Het
Eri2	A	G	7: 119,793,916		probably null	Het
Foxa3	A	G	7: 19,023,369	Y17H	probably damaging	Het
Fto	T	C	8: 91,474,312	S324P	probably damaging	Het
Gls2	T	G	10: 128,207,311	L457R	probably benign	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Gtf3c1	G	A	7: 125,647,614	R1508*	probably null	Het
Kif21a	T	C	15: 90,969,774		probably null	Het
Klra5	A	T	6: 129,906,614	D93E	possibly damaging	Het
Lgr5	T	C	10: 115,454,499	D456G	probably damaging	Het
Mau2	A	G	8: 70,030,655	S186P	probably damaging	Het
Msr1	T	C	8: 39,589,382	D384G	possibly damaging	Het
Mum1	C	A	10: 80,238,879		probably null	Het
Ncf4	T	C	15: 78,253,303	V93A	probably damaging	Het
Oas1f	T	G	5: 120,856,426	C337G	probably damaging	Het
Olfr119	A	G	17: 37,701,041	M124V	probably damaging	Het
Olfr482	A	T	7: 108,095,222	F116Y	probably benign	Het
Olfr820	T	A	10: 130,018,003	L214H	probably damaging	Het
Rasl10b	T	C	11: 83,418,693	S159P	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Smg8	C	A	11: 87,080,423	D841Y	probably damaging	Het
Sox7	T	C	14: 63,943,949	V65A	probably damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Srsf10	A	G	4: 135,863,190	Y142C	possibly damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcerg1l	A	G	7: 138,276,655	V326A	probably benign	Het
Tcl1b5	T	A	12: 105,179,067	W97R	probably damaging	Het
Tmem108	T	C	9: 103,499,657	R198G	possibly damaging	Het
Ube2ql1	T	A	13: 69,738,898	Q148L	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,585	I82L	probably benign	Het
Wdr6	A	T	9: 108,575,864	S273R	probably damaging	Het
Ylpm1	C	T	12: 84,997,076		probably benign	Het
Zfp90	G	A	8: 106,425,506	R617Q	possibly damaging	Het

Other mutations in Bub1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Bub1b	APN	2	118630138	missense	probably benign
IGL01319:Bub1b	APN	2	118614994	missense	possibly damaging	0.49
IGL01744:Bub1b	APN	2	118636749	missense	probably damaging	0.99
IGL03184:Bub1b	APN	2	118609777	splice site	probably benign
P0035:Bub1b	UTSW	2	118622185	missense	probably damaging	1.00
R0315:Bub1b	UTSW	2	118626976	splice site	probably benign
R0322:Bub1b	UTSW	2	118639618	splice site	probably benign
R0457:Bub1b	UTSW	2	118609859	missense	probably damaging	1.00
R0845:Bub1b	UTSW	2	118609976	missense	probably damaging	1.00
R0960:Bub1b	UTSW	2	118606680	missense	probably benign	0.03
R1071:Bub1b	UTSW	2	118632447	frame shift	probably null
R1129:Bub1b	UTSW	2	118615006	missense	probably damaging	1.00
R1138:Bub1b	UTSW	2	118623089	missense	probably benign	0.01
R1171:Bub1b	UTSW	2	118606686	missense	probably benign	0.31
R1613:Bub1b	UTSW	2	118639741	critical splice donor site	probably null
R1667:Bub1b	UTSW	2	118641189	missense	probably benign	0.00
R1812:Bub1b	UTSW	2	118632421	missense	probably benign	0.00
R1828:Bub1b	UTSW	2	118638439	missense	probably benign	0.00
R2085:Bub1b	UTSW	2	118622195	missense	possibly damaging	0.88
R2137:Bub1b	UTSW	2	118636718	nonsense	probably null
R3749:Bub1b	UTSW	2	118615455	missense	possibly damaging	0.63
R3750:Bub1b	UTSW	2	118615455	missense	possibly damaging	0.63
R4211:Bub1b	UTSW	2	118630978	missense	possibly damaging	0.78
R4579:Bub1b	UTSW	2	118623176	nonsense	probably null
R4993:Bub1b	UTSW	2	118636770	missense	possibly damaging	0.63
R5144:Bub1b	UTSW	2	118615499	missense	possibly damaging	0.92
R5229:Bub1b	UTSW	2	118629989	missense	probably damaging	1.00
R5596:Bub1b	UTSW	2	118630982	missense	probably damaging	1.00
R5656:Bub1b	UTSW	2	118605431	missense	probably damaging	1.00
R5785:Bub1b	UTSW	2	118609844	missense	probably damaging	0.98
R5883:Bub1b	UTSW	2	118609882	missense	probably damaging	1.00
R6128:Bub1b	UTSW	2	118617812	missense	probably benign
R6187:Bub1b	UTSW	2	118631000	missense	probably damaging	1.00
R6333:Bub1b	UTSW	2	118598463	critical splice donor site	probably null
R6985:Bub1b	UTSW	2	118606614	missense	probably damaging	1.00
R6988:Bub1b	UTSW	2	118636830	missense	probably damaging	0.96
R7161:Bub1b	UTSW	2	118626053	missense	probably damaging	1.00
R7341:Bub1b	UTSW	2	118636786	missense	possibly damaging	0.95
R7575:Bub1b	UTSW	2	118641158	missense	possibly damaging	0.51
R7824:Bub1b	UTSW	2	118626967	splice site	probably null
R8129:Bub1b	UTSW	2	118638494	missense	probably benign	0.06
R8702:Bub1b	UTSW	2	118638494	missense	probably benign	0.06
R8787:Bub1b	UTSW	2	118631824	missense	probably damaging	1.00
R9569:Bub1b	UTSW	2	118638403	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTGTGCCTTCAAGAGTGTTTG -3'
(R):5'- AAGCTGTGCTACTGAGAGTGACCC -3'

Sequencing Primer
(F):5'- CCTTCAAGAGTGTTTGAATGATCTCC -3'
(R):5'- CCCTAGTGAAGGACTGCTGATG -3'

Posted On

2013-05-09