Incidental Mutation 'R4092:Sorcs2'
ID 368225
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4092 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36183166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1036 (K1036E)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: K1036E

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: K1036E

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,055,903 (GRCm39) H340Q probably benign Het
Adam22 A T 5: 8,145,004 (GRCm39) I116N probably damaging Het
Adamts2 T A 11: 50,678,103 (GRCm39) V794E probably damaging Het
Ak9 T C 10: 41,265,140 (GRCm39) S966P probably benign Het
Alox5 G A 6: 116,389,635 (GRCm39) probably benign Het
Bmerb1 G A 16: 13,867,346 (GRCm39) R68H probably damaging Het
Brip1 C T 11: 86,039,347 (GRCm39) D396N possibly damaging Het
Catsper3 C T 13: 55,932,484 (GRCm39) H4Y probably benign Het
Cmtm2a T C 8: 105,019,403 (GRCm39) Y62C probably benign Het
Crim1 T C 17: 78,658,265 (GRCm39) C715R probably damaging Het
Dio3 A G 12: 110,246,234 (GRCm39) D190G possibly damaging Het
Efl1 A G 7: 82,412,035 (GRCm39) E808G probably benign Het
Eif1ad16 A T 12: 87,985,194 (GRCm39) N116K possibly damaging Het
Fam83b T C 9: 76,398,943 (GRCm39) D720G probably benign Het
Fbp2 C T 13: 62,988,174 (GRCm39) V246M possibly damaging Het
Gm10197 G A 19: 53,360,196 (GRCm39) probably benign Het
Icam2 C A 11: 106,271,623 (GRCm39) M1I probably null Het
Insyn2b G A 11: 34,351,935 (GRCm39) probably benign Het
Kit T C 5: 75,771,470 (GRCm39) I209T probably benign Het
Lcmt1 T C 7: 123,017,476 (GRCm39) V200A probably damaging Het
Lrrn2 C T 1: 132,865,390 (GRCm39) Q152* probably null Het
Mmadhc A G 2: 50,177,895 (GRCm39) M174T probably benign Het
N4bp2 A G 5: 65,947,799 (GRCm39) N143S probably benign Het
Ndufs1 G A 1: 63,196,405 (GRCm39) A340V possibly damaging Het
Nid1 A G 13: 13,661,224 (GRCm39) D708G probably damaging Het
Noc2l A C 4: 156,327,033 (GRCm39) T295P probably damaging Het
Nutm1 T A 2: 112,079,809 (GRCm39) N702I probably damaging Het
Obscn T A 11: 58,946,886 (GRCm39) M4083L probably benign Het
Or5b104 T C 19: 13,072,790 (GRCm39) Y74C probably damaging Het
Otol1 T A 3: 69,935,118 (GRCm39) I370N probably damaging Het
Paip1 T G 13: 119,586,449 (GRCm39) S58A probably benign Het
Pfas T C 11: 68,884,775 (GRCm39) T476A probably benign Het
Plppr3 G T 10: 79,703,314 (GRCm39) R57S probably damaging Het
Ptgir T C 7: 16,640,932 (GRCm39) S75P probably damaging Het
Raver1 A T 9: 20,992,568 (GRCm39) L287Q probably damaging Het
Rps6ka4 C T 19: 6,809,623 (GRCm39) probably null Het
Rps6-ps2 A G 8: 89,533,319 (GRCm39) noncoding transcript Het
Scn11a T A 9: 119,619,036 (GRCm39) M769L probably benign Het
Serpina16 G T 12: 103,638,836 (GRCm39) H250Q probably benign Het
Serpina3a G A 12: 104,082,625 (GRCm39) V133I probably benign Het
Slc12a8 G A 16: 33,437,491 (GRCm39) G308D probably damaging Het
Slfn5 T C 11: 82,851,893 (GRCm39) L673P probably damaging Het
Speer3 C G 5: 13,846,394 (GRCm39) A238G possibly damaging Het
Sptbn5 C A 2: 119,897,532 (GRCm39) E550D probably damaging Het
Srgap3 G T 6: 112,700,045 (GRCm39) P1002T probably benign Het
Tollip C T 7: 141,438,180 (GRCm39) R181H probably damaging Het
Trmt1l T A 1: 151,330,784 (GRCm39) S600R probably benign Het
Vps16 T A 2: 130,281,832 (GRCm39) Y315N probably damaging Het
Vps50 A G 6: 3,551,037 (GRCm39) E367G probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGAAGCTGCCTAATCTC -3'
(R):5'- TATGGATCAGGGCAGGTGAC -3'

Sequencing Primer
(F):5'- CTCACTAACCTTGGATGCTGTTGAG -3'
(R):5'- CAGATCTTGCTAGAAACTTAGCC -3'
Posted On 2016-01-07