Incidental Mutation 'R4092:Sorcs2'
ID368225
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Namesortilin-related VPS10 domain containing receptor 2
SynonymsVPS10 domain receptor protein
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4092 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location36017180-36398139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36025822 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1036 (K1036E)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: K1036E

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: K1036E

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,293,273 H340Q probably benign Het
2900011O08Rik G A 16: 14,049,482 R68H probably damaging Het
Adam22 A T 5: 8,095,004 I116N probably damaging Het
Adamts2 T A 11: 50,787,276 V794E probably damaging Het
Ak9 T C 10: 41,389,144 S966P probably benign Het
Alox5 G A 6: 116,412,674 probably benign Het
Brip1 C T 11: 86,148,521 D396N possibly damaging Het
Catsper3 C T 13: 55,784,671 H4Y probably benign Het
Cmtm2a T C 8: 104,292,771 Y62C probably benign Het
Crim1 T C 17: 78,350,836 C715R probably damaging Het
Dio3 A G 12: 110,279,800 D190G possibly damaging Het
Efl1 A G 7: 82,762,827 E808G probably benign Het
Fam196b G A 11: 34,401,935 probably benign Het
Fam83b T C 9: 76,491,661 D720G probably benign Het
Fbp2 C T 13: 62,840,360 V246M possibly damaging Het
Gm10197 G A 19: 53,371,765 probably benign Het
Gm6803 A T 12: 88,018,424 N116K possibly damaging Het
Icam2 C A 11: 106,380,797 M1I probably null Het
Kit T C 5: 75,610,810 I209T probably benign Het
Lcmt1 T C 7: 123,418,253 V200A probably damaging Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Mmadhc A G 2: 50,287,883 M174T probably benign Het
N4bp2 A G 5: 65,790,456 N143S probably benign Het
Ndufs1 G A 1: 63,157,246 A340V possibly damaging Het
Nid1 A G 13: 13,486,639 D708G probably damaging Het
Noc2l A C 4: 156,242,576 T295P probably damaging Het
Nutm1 T A 2: 112,249,464 N702I probably damaging Het
Obscn T A 11: 59,056,060 M4083L probably benign Het
Olfr1457 T C 19: 13,095,426 Y74C probably damaging Het
Otol1 T A 3: 70,027,785 I370N probably damaging Het
Paip1 T G 13: 119,449,913 S58A probably benign Het
Pfas T C 11: 68,993,949 T476A probably benign Het
Plppr3 G T 10: 79,867,480 R57S probably damaging Het
Ptgir T C 7: 16,907,007 S75P probably damaging Het
Raver1 A T 9: 21,081,272 L287Q probably damaging Het
Rps6ka4 C T 19: 6,832,255 probably null Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a T A 9: 119,789,970 M769L probably benign Het
Serpina16 G T 12: 103,672,577 H250Q probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc12a8 G A 16: 33,617,121 G308D probably damaging Het
Slfn5 T C 11: 82,961,067 L673P probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sptbn5 C A 2: 120,067,051 E550D probably damaging Het
Srgap3 G T 6: 112,723,084 P1002T probably benign Het
Tollip C T 7: 141,884,443 R181H probably damaging Het
Trmt1l T A 1: 151,455,033 S600R probably benign Het
Vps16 T A 2: 130,439,912 Y315N probably damaging Het
Vps50 A G 6: 3,551,037 E367G probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36037401 splice site probably null
IGL01064:Sorcs2 APN 5 36065352 missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36021252 missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36047809 missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36025942 missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36062552 missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36077957 missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36068148 missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36065331 unclassified probably benign
IGL03141:Sorcs2 APN 5 36065355 missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36031212 missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36046504 missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36153845 missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36397553 splice site probably benign
R0345:Sorcs2 UTSW 5 36027874 missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36031190 missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36065433 missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36024572 missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36027925 missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36026748 missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36229220 splice site probably benign
R1935:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36042086 splice site probably null
R3148:Sorcs2 UTSW 5 36035788 missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36397806 missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36397663 nonsense probably null
R4620:Sorcs2 UTSW 5 36037494 missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36043452 missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36039390 missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36031183 missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36046530 nonsense probably null
R5727:Sorcs2 UTSW 5 36031286 missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36229211 missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36229191 missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36029083 missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36019384 missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36027988 splice site probably null
R6290:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36077966 missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36397810 missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36021261 missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36068130 missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36025876 missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36027978 missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36043527 missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36024072 missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36024614 missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36062614 missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36062588 missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36038206 missense probably benign 0.00
RF063:Sorcs2 UTSW 5 36153811 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGAAGCTGCCTAATCTC -3'
(R):5'- TATGGATCAGGGCAGGTGAC -3'

Sequencing Primer
(F):5'- CTCACTAACCTTGGATGCTGTTGAG -3'
(R):5'- CAGATCTTGCTAGAAACTTAGCC -3'
Posted On2016-01-07