Mutagenetix > Incidental Mutation

Incidental Mutation 'R7748:Sorcs2'

596980

Institutional Source

Beutler Lab

Gene Symbol

Sorcs2

Ensembl Gene

ENSMUSG00000029093

Gene Name

sortilin-related VPS10 domain containing receptor 2

Synonyms

VPS10 domain receptor protein

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7748 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36017180-36398139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36229175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 173 (M173K)

Ref Sequence

ENSEMBL: ENSMUSP00000041828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000070720] [ENSMUST00000135324]

AlphaFold

Q9EPR5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037370
AA Change: M173K

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: M173K

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
VPS10	170	780	N/A	SMART
PKD	782	872	7.27e-2	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070720
AA Change: M173K

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093
AA Change: M173K

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
Blast:VPS10	170	213	2e-22	BLAST
low complexity region	214	227	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000135324
AA Change: M1K

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000123543
Gene: ENSMUSG00000029093
AA Change: M1K

Domain	Start	End	E-Value	Type
SCOP:d1eur__	1	111	2e-3	SMART
Blast:VPS10	1	173	1e-126	BLAST
PDB:4N7E\|A	6	117	1e-8	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	T	A	7: 131,361,792	L103F	probably benign	Het
4932438A13Rik	A	G	3: 36,959,335		probably null	Het
5330417H12Rik	A	G	7: 107,624,558	L103P	unknown	Het
Actb	T	C	5: 142,904,695	I151V	probably benign	Het
Adcy6	T	A	15: 98,604,556	H59L	probably benign	Het
Adss	G	C	1: 177,772,202	S272*	probably null	Het
Aga	A	T	8: 53,511,805	M1L	possibly damaging	Het
Anxa5	G	A	3: 36,465,331	T3M	probably damaging	Het
Arhgap45	A	T	10: 80,016,932		probably benign	Het
Atp6v0a2	A	T	5: 124,716,496	H639L	probably benign	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bod1l	A	C	5: 41,832,340	S347A	probably damaging	Het
Calcoco1	T	C	15: 102,719,561	D46G	probably damaging	Het
Camk1	T	C	6: 113,340,328	E60G	probably damaging	Het
Capza1	A	T	3: 104,825,405		probably null	Het
Ccdc18	T	A	5: 108,149,041		probably null	Het
Cdh20	G	A	1: 104,941,299	A172T	probably damaging	Het
Cdk4	C	T	10: 127,064,429	A65V	possibly damaging	Het
Cftr	T	C	6: 18,277,889		probably null	Het
Chd3	T	C	11: 69,355,633	M1092V	probably benign	Het
Chd6	A	T	2: 160,966,619	H1558Q	probably benign	Het
Chil1	A	G	1: 134,189,228	H318R	probably benign	Het
Cps1	A	G	1: 67,139,806	Y59C	probably damaging	Het
Cyb5r4	T	C	9: 87,032,381	V111A	probably damaging	Het
D430042O09Rik	A	T	7: 125,829,801	M558L	probably benign	Het
Ddx39b	G	A	17: 35,252,750	V291M	probably damaging	Het
Dhx57	A	G	17: 80,265,117	F709S	probably damaging	Het
Eef1b2	A	T	1: 63,177,865	K64N	probably damaging	Het
Fam135a	A	G	1: 24,028,969	S940P	probably benign	Het
Fam234b	T	A	6: 135,209,351	V119E	probably damaging	Het
Fbxo46	G	C	7: 19,136,533	C359S	probably damaging	Het
Fkbp14	C	A	6: 54,595,520		probably benign	Het
Fmn2	T	A	1: 174,666,649	V1243E	probably damaging	Het
Fsbp	C	A	4: 11,579,924	T64K	probably damaging	Het
Fscb	A	T	12: 64,474,407	M95K	probably benign	Het
Fyb	T	G	15: 6,638,826	V500G	probably damaging	Het
G2e3	A	G	12: 51,371,667	N615S	probably benign	Het
Gart	T	C	16: 91,630,652	D486G	possibly damaging	Het
Gas2l2	T	A	11: 83,422,398	D696V	probably benign	Het
Glmn	C	T	5: 107,562,244		probably null	Het
Gm47985	A	T	1: 151,182,974	D122V	probably damaging	Het
Gm49333	A	T	16: 20,633,084	D407V	probably damaging	Het
Gm7168	A	G	17: 13,948,652	K94E	probably benign	Het
Gm996	T	A	2: 25,578,959	E313D	possibly damaging	Het
Gnai2	T	C	9: 107,615,735	H323R		Het
Helz2	C	T	2: 181,234,531	R1390H	probably damaging	Het
Igf2bp1	T	C	11: 95,967,587	M453V	probably benign	Het
Ighv3-1	C	T	12: 113,964,650	V30M	probably damaging	Het
Inpp5a	A	T	7: 139,574,995	R343S	probably damaging	Het
Itga8	T	A	2: 12,230,239	I403F	possibly damaging	Het
Krt33a	C	T	11: 100,011,602	R404H	probably benign	Het
Krt34	T	A	11: 100,038,938	E244V	probably damaging	Het
Krt42	T	C	11: 100,266,966	E224G	probably damaging	Het
Krtap5-2	TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA	TCCACAGGAACTACA	7: 142,175,108		probably benign	Het
Lama1	T	C	17: 67,750,590	L553P		Het
Lcn9	T	A	2: 25,824,914	*179K	probably null	Het
Lrrc2	T	G	9: 110,980,931	M345R	possibly damaging	Het
March11	T	C	15: 26,387,830	V257A	probably damaging	Het
Masp2	T	C	4: 148,605,706	I224T	probably benign	Het
Mpz	A	T	1: 171,159,940		probably null	Het
Mtr	C	T	13: 12,227,839	A442T	probably benign	Het
Muc5b	A	G	7: 141,847,805	K596R	unknown	Het
Myo15	T	G	11: 60,504,901	F1397C		Het
Ncor2	T	C	5: 125,109,967	I173V	unknown	Het
Ngly1	T	A	14: 16,290,820	I434K	possibly damaging	Het
Notch2	A	G	3: 98,138,484	H1655R	possibly damaging	Het
Notum	C	T	11: 120,654,801	A390T	probably damaging	Het
Olfr381	T	G	11: 73,486,168	I219L	probably benign	Het
Olfr519	T	C	7: 108,894,078	T115A	probably benign	Het
Pds5a	T	A	5: 65,619,666	I51F	possibly damaging	Het
Pdzd2	C	A	15: 12,385,786	R966L	possibly damaging	Het
Plk3	T	C	4: 117,131,728	Y278C	probably damaging	Het
Plxna1	C	G	6: 89,337,352		probably null	Het
Plxna1	T	A	6: 89,337,353		probably null	Het
Ppp4r4	G	A	12: 103,605,061		probably null	Het
Pramel6	T	A	2: 87,508,699	V81E	probably damaging	Het
Prdm2	T	C	4: 143,135,889	E277G	possibly damaging	Het
Prkg1	T	A	19: 30,993,091	I222F	possibly damaging	Het
Proser3	A	T	7: 30,540,072	S536T	possibly damaging	Het
Prrt4	C	A	6: 29,177,191	G193V	probably damaging	Het
Ptpn21	A	T	12: 98,688,772	H645Q	probably benign	Het
Ptprd	T	C	4: 76,099,504	I744V	probably null	Het
Rad54l2	A	G	9: 106,719,034	V235A	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rgs22	C	T	15: 36,122,269		probably null	Het
Rtcb	A	T	10: 85,941,968	D447E	probably benign	Het
Rtn1	C	T	12: 72,216,926	V744I	possibly damaging	Het
Scfd1	T	G	12: 51,389,357	I96M	probably benign	Het
Serpina3b	T	C	12: 104,130,463	M1T	probably null	Het
Slc1a4	T	C	11: 20,332,252	Y74C	probably damaging	Het
Slc9b2	A	T	3: 135,326,179	I267F	possibly damaging	Het
Sparc	T	C	11: 55,398,600	I226V	probably benign	Het
Spata22	T	G	11: 73,336,254	I98S	probably null	Het
Spef2	C	T	15: 9,652,945	V917M	probably damaging	Het
Sspo	C	A	6: 48,449,465	C139*	probably null	Het
Tenm4	A	G	7: 96,894,702	D2012G	probably damaging	Het
Tgm5	G	A	2: 121,052,808	R351C	probably damaging	Het
Tmem145	G	A	7: 25,307,328	W82*	probably null	Het
Tmem159	A	T	7: 120,115,479	I64F	possibly damaging	Het
Topors	T	A	4: 40,262,654	D210V	probably damaging	Het
Tssk4	A	T	14: 55,651,112	H146L	probably damaging	Het
Unc93b1	T	A	19: 3,935,250	D19E	unknown	Het
Usp17lc	A	G	7: 103,418,481	T328A	probably damaging	Het
Utrn	A	G	10: 12,614,508	Y43H	probably benign	Het
Vmn1r25	T	A	6: 57,978,564	I247F	probably damaging	Het
Vmn2r78	A	T	7: 86,921,135	Q287L	probably benign	Het
Vps13c	T	A	9: 67,963,089	I3170N	probably benign	Het
Zfc3h1	T	A	10: 115,400,815	M398K	probably benign	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp773	T	C	7: 7,132,908	R230G	probably benign	Het

Other mutations in Sorcs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Sorcs2	APN	5	36037401	splice site	probably null
IGL01064:Sorcs2	APN	5	36065352	missense	probably damaging	1.00
IGL01120:Sorcs2	APN	5	36021252	missense	probably damaging	0.99
IGL01730:Sorcs2	APN	5	36047809	missense	probably damaging	1.00
IGL02542:Sorcs2	APN	5	36025942	missense	probably damaging	0.98
IGL02730:Sorcs2	APN	5	36062552	missense	probably benign	0.11
IGL02965:Sorcs2	APN	5	36077957	missense	probably benign	0.13
IGL02997:Sorcs2	APN	5	36068148	missense	probably damaging	1.00
IGL03000:Sorcs2	APN	5	36065331	unclassified	probably benign
IGL03141:Sorcs2	APN	5	36065355	missense	probably benign	0.01
IGL03184:Sorcs2	APN	5	36031212	missense	probably benign	0.01
IGL03412:Sorcs2	APN	5	36046504	missense	probably damaging	1.00
R0180:Sorcs2	UTSW	5	36153845	missense	probably damaging	1.00
R0244:Sorcs2	UTSW	5	36397553	splice site	probably benign
R0345:Sorcs2	UTSW	5	36027874	missense	probably benign	0.01
R0519:Sorcs2	UTSW	5	36031190	missense	probably benign	0.08
R0624:Sorcs2	UTSW	5	36065433	missense	probably damaging	0.97
R0625:Sorcs2	UTSW	5	36024572	missense	possibly damaging	0.65
R1169:Sorcs2	UTSW	5	36027925	missense	possibly damaging	0.70
R1721:Sorcs2	UTSW	5	36026748	missense	probably damaging	0.98
R1809:Sorcs2	UTSW	5	36229220	splice site	probably benign
R1935:Sorcs2	UTSW	5	36071387	missense	possibly damaging	0.88
R1936:Sorcs2	UTSW	5	36071387	missense	possibly damaging	0.88
R2279:Sorcs2	UTSW	5	36042086	splice site	probably null
R3148:Sorcs2	UTSW	5	36035788	missense	probably benign	0.09
R3803:Sorcs2	UTSW	5	36397806	missense	probably benign	0.36
R3863:Sorcs2	UTSW	5	36397663	nonsense	probably null
R4092:Sorcs2	UTSW	5	36025822	missense	possibly damaging	0.92
R4620:Sorcs2	UTSW	5	36037494	missense	probably benign	0.00
R5079:Sorcs2	UTSW	5	36043452	missense	probably damaging	1.00
R5301:Sorcs2	UTSW	5	36039390	missense	probably damaging	1.00
R5470:Sorcs2	UTSW	5	36031183	missense	probably benign	0.00
R5568:Sorcs2	UTSW	5	36046530	nonsense	probably null
R5727:Sorcs2	UTSW	5	36031286	missense	possibly damaging	0.52
R5874:Sorcs2	UTSW	5	36229211	missense	probably damaging	1.00
R5890:Sorcs2	UTSW	5	36229191	missense	probably damaging	1.00
R5946:Sorcs2	UTSW	5	36029083	missense	probably damaging	1.00
R6005:Sorcs2	UTSW	5	36019384	missense	probably damaging	1.00
R6048:Sorcs2	UTSW	5	36027988	splice site	probably null
R6290:Sorcs2	UTSW	5	36062587	missense	probably damaging	1.00
R6292:Sorcs2	UTSW	5	36062587	missense	probably damaging	1.00
R6617:Sorcs2	UTSW	5	36077966	missense	probably damaging	1.00
R6681:Sorcs2	UTSW	5	36397810	missense	probably benign	0.00
R7024:Sorcs2	UTSW	5	36021261	missense	probably damaging	0.99
R7056:Sorcs2	UTSW	5	36068130	missense	probably damaging	1.00
R7569:Sorcs2	UTSW	5	36025876	missense	probably benign	0.01
R7641:Sorcs2	UTSW	5	36397952	missense	probably damaging	0.99
R7651:Sorcs2	UTSW	5	36027978	missense	probably damaging	1.00
R7674:Sorcs2	UTSW	5	36397952	missense	probably damaging	0.99
R7722:Sorcs2	UTSW	5	36043527	missense	probably damaging	1.00
R7764:Sorcs2	UTSW	5	36024072	missense	possibly damaging	0.48
R7813:Sorcs2	UTSW	5	36024614	missense	probably damaging	1.00
R8142:Sorcs2	UTSW	5	36062614	missense	possibly damaging	0.67
R8246:Sorcs2	UTSW	5	36062588	missense	probably damaging	1.00
R8254:Sorcs2	UTSW	5	36038206	missense	probably benign	0.00
R8349:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R8350:Sorcs2	UTSW	5	36153863	missense	probably damaging	0.96
R8354:Sorcs2	UTSW	5	36065409	missense	probably benign	0.01
R8449:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R8679:Sorcs2	UTSW	5	36039313	missense	probably benign	0.09
R8771:Sorcs2	UTSW	5	36031280	missense	probably damaging	1.00
R8935:Sorcs2	UTSW	5	36035858	missense	possibly damaging	0.79
R8964:Sorcs2	UTSW	5	36229167	missense	possibly damaging	0.85
R9164:Sorcs2	UTSW	5	36077968	missense	possibly damaging	0.94
R9221:Sorcs2	UTSW	5	36024566	critical splice donor site	probably null
R9290:Sorcs2	UTSW	5	36025881	missense	probably damaging	0.96
R9358:Sorcs2	UTSW	5	36043470	missense	probably damaging	1.00
R9492:Sorcs2	UTSW	5	36029140	missense	probably benign	0.08
R9493:Sorcs2	UTSW	5	36042185	missense	possibly damaging	0.61
R9640:Sorcs2	UTSW	5	36065421	nonsense	probably null
RF063:Sorcs2	UTSW	5	36153811	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGACGAAACTCCTAATCCGCTC -3'
(R):5'- TCCGAAGAAGAGACTAGGTCC -3'

Sequencing Primer
(F):5'- AATCCGCTCTCAACCTCTCCATTATG -3'
(R):5'- CCAAGTCTCAATGTTATGATACTCGG -3'

Posted On

2019-11-26