Incidental Mutation 'R8771:Sorcs2'
ID 664400
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 068602-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8771 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36188624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 828 (Y828C)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect probably damaging
Transcript: ENSMUST00000037370
AA Change: Y828C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: Y828C

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,880,320 (GRCm39) I451T probably damaging Het
Acin1 T C 14: 54,880,496 (GRCm39) K1236E unknown Het
AI661453 T C 17: 47,777,683 (GRCm39) S470P unknown Het
Ano5 C A 7: 51,216,095 (GRCm39) N357K probably damaging Het
Ano5 C T 7: 51,220,047 (GRCm39) Q396* probably null Het
Baz1b T A 5: 135,273,151 (GRCm39) M1425K probably benign Het
Cdh22 A T 2: 164,988,689 (GRCm39) V222E possibly damaging Het
Celsr1 A T 15: 85,788,175 (GRCm39) S2692R probably benign Het
Ces5a A G 8: 94,255,249 (GRCm39) I144T possibly damaging Het
D5Ertd579e T A 5: 36,761,940 (GRCm39) N1309I probably damaging Het
Dnmt3b C T 2: 153,504,734 (GRCm39) T112M possibly damaging Het
Eif4g3 C T 4: 137,907,848 (GRCm39) Q1283* probably null Het
Etnppl T A 3: 130,414,024 (GRCm39) M41K probably damaging Het
Hhatl G A 9: 121,617,776 (GRCm39) T271I possibly damaging Het
Igkv5-37 A G 6: 69,940,423 (GRCm39) S74P probably damaging Het
Krt87 A G 15: 101,385,779 (GRCm39) V272A probably benign Het
Lgr6 A T 1: 134,933,429 (GRCm39) L262* probably null Het
Lrriq3 G A 3: 154,899,270 (GRCm39) V590I probably damaging Het
Mfsd13a T C 19: 46,360,668 (GRCm39) V382A probably damaging Het
Minar2 T C 18: 59,200,052 (GRCm39) probably benign Het
Mrc2 A G 11: 105,240,596 (GRCm39) T1429A probably benign Het
Mroh5 A T 15: 73,693,203 (GRCm39) M79K possibly damaging Het
Myo1c A G 11: 75,556,709 (GRCm39) K553R probably benign Het
Nbeal1 A G 1: 60,300,743 (GRCm39) T1488A probably benign Het
Or4c12 T C 2: 89,773,565 (GRCm39) K298R probably benign Het
Or5aq6 T C 2: 86,923,294 (GRCm39) Y149C probably benign Het
Or5m10b T G 2: 85,699,712 (GRCm39) Y259D probably damaging Het
Or5p76 T A 7: 108,122,632 (GRCm39) N175I possibly damaging Het
Prl7a1 A T 13: 27,819,811 (GRCm39) W148R probably damaging Het
Ptpn2 G T 18: 67,805,659 (GRCm39) T402K probably benign Het
Ptprf A G 4: 118,068,987 (GRCm39) M1665T possibly damaging Het
Raet1e G T 10: 22,057,041 (GRCm39) V122F probably damaging Het
Serpina3m A G 12: 104,357,841 (GRCm39) E255G probably damaging Het
Sprr1a T A 3: 92,391,989 (GRCm39) H4L probably benign Het
Sptssa A G 12: 54,703,211 (GRCm39) Y20H probably damaging Het
Synpo2l A G 14: 20,710,491 (GRCm39) S939P probably damaging Het
Tdrd7 T C 4: 46,010,800 (GRCm39) V568A probably damaging Het
Tmem132c C T 5: 127,437,192 (GRCm39) P227L probably benign Het
Tmtc3 A G 10: 100,286,180 (GRCm39) S548P possibly damaging Het
Trip12 A T 1: 84,721,018 (GRCm39) probably benign Het
Ttll6 A G 11: 96,042,762 (GRCm39) Y436C probably damaging Het
Unc80 A G 1: 66,685,554 (GRCm39) D2226G possibly damaging Het
Vmn1r142 T C 7: 21,862,737 (GRCm39) M242V probably benign Het
Vmn2r12 T G 5: 109,239,952 (GRCm39) T204P possibly damaging Het
Vmn2r16 C T 5: 109,488,231 (GRCm39) T368M probably benign Het
Vmn2r61 C A 7: 41,916,194 (GRCm39) A269D probably damaging Het
Zfp148 A G 16: 33,317,656 (GRCm39) D776G possibly damaging Het
Zfp775 A T 6: 48,596,906 (GRCm39) Q260L probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCCCACAAGATTCCCTGTG -3'
(R):5'- AACCTACTCTCTGGCCTCAAAG -3'

Sequencing Primer
(F):5'- GCCCTGGCTCTTAATTTCAAG -3'
(R):5'- TCTCTGGCCTCAAAGAGCCTG -3'
Posted On 2021-03-08