Incidental Mutation 'R4881:Zfp407'
ID 375312
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Name zinc finger protein 407
Synonyms 6430585N13Rik, LOC240469, LOC381139
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4881 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 84128027-84589725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84559703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1095 (H1095R)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
AlphaFold G3UVV3
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect probably benign
Transcript: ENSMUST00000125763
AA Change: H1095R

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: H1095R

low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182297
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 913 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84561752 missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84562720 nonsense probably null
IGL02110:Zfp407 APN 18 84559040 missense probably benign 0.00
IGL02343:Zfp407 APN 18 84209724 missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84558641 missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84559031 nonsense probably null
IGL02946:Zfp407 APN 18 84560709 missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84350975 missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84209721 missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84560797 missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84209955 missense probably damaging 0.99
PIT4362001:Zfp407 UTSW 18 84561268 missense possibly damaging 0.87
PIT4520001:Zfp407 UTSW 18 84432420 missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84560411 missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84558711 missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84562567 missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R0787:Zfp407 UTSW 18 84209022 missense probably damaging 1.00
R0787:Zfp407 UTSW 18 84209346 missense probably benign 0.00
R1065:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1086:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1165:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1186:Zfp407 UTSW 18 84209448 missense probably benign 0.39
R1203:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1312:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1345:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1385:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1421:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1430:Zfp407 UTSW 18 84209455 missense probably benign 0.18
R1436:Zfp407 UTSW 18 84343071 splice site probably benign
R1498:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1526:Zfp407 UTSW 18 84561033 missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84209638 missense probably benign 0.00
R1594:Zfp407 UTSW 18 84209331 missense probably benign 0.01
R1628:Zfp407 UTSW 18 84354533 missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84562157 missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84559336 missense probably benign 0.01
R1984:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1985:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1986:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R2151:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84209793 missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84559880 missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84558397 nonsense probably null
R3407:Zfp407 UTSW 18 84558872 missense probably benign 0.08
R3432:Zfp407 UTSW 18 84208746 missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84560352 missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84559596 missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84343007 missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84562731 nonsense probably null
R4447:Zfp407 UTSW 18 84562694 missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84562914 missense probably benign 0.01
R4936:Zfp407 UTSW 18 84559464 missense probably benign 0.00
R5194:Zfp407 UTSW 18 84561309 missense probably benign 0.05
R5243:Zfp407 UTSW 18 84561091 missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84315926 missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84561137 missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84561044 missense probably benign 0.35
R5739:Zfp407 UTSW 18 84208742 makesense probably null
R5806:Zfp407 UTSW 18 84558614 missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84560524 missense probably benign 0.01
R6187:Zfp407 UTSW 18 84559009 missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84560349 missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84432411 missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84208830 missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84343069 splice site probably null
R6899:Zfp407 UTSW 18 84561434 missense possibly damaging 0.86
R7038:Zfp407 UTSW 18 84561857 missense probably damaging 1.00
R7076:Zfp407 UTSW 18 84558476 missense probably damaging 1.00
R7326:Zfp407 UTSW 18 84559042 missense possibly damaging 0.77
R7397:Zfp407 UTSW 18 84561819 missense possibly damaging 0.59
R7402:Zfp407 UTSW 18 84561536 missense probably benign 0.02
R7783:Zfp407 UTSW 18 84209922 missense possibly damaging 0.69
R7800:Zfp407 UTSW 18 84560675 missense probably damaging 0.99
R7904:Zfp407 UTSW 18 84561256 missense not run
R7942:Zfp407 UTSW 18 84559629 missense probably benign 0.02
R7955:Zfp407 UTSW 18 84559291 missense probably benign 0.02
R7988:Zfp407 UTSW 18 84559400 missense possibly damaging 0.60
R8125:Zfp407 UTSW 18 84561185 missense probably damaging 1.00
R8237:Zfp407 UTSW 18 84560144 missense possibly damaging 0.87
R8364:Zfp407 UTSW 18 84552868 critical splice donor site probably null
R8443:Zfp407 UTSW 18 84209862 missense probably damaging 1.00
R8487:Zfp407 UTSW 18 84562770 nonsense probably null
R8497:Zfp407 UTSW 18 84559896 missense probably damaging 0.98
R8808:Zfp407 UTSW 18 84343060 missense probably benign 0.17
R8848:Zfp407 UTSW 18 84560694 missense probably damaging 1.00
R8913:Zfp407 UTSW 18 84560528 missense probably damaging 0.99
R8962:Zfp407 UTSW 18 84558932 missense probably damaging 1.00
R9087:Zfp407 UTSW 18 84209857 missense probably damaging 0.96
RF003:Zfp407 UTSW 18 84209563 missense probably benign 0.17
Z1177:Zfp407 UTSW 18 84209954 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-03-17