Incidental Mutation 'R4447:Zfp407'
ID328815
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Namezinc finger protein 407
Synonyms6430585N13Rik, LOC240469, LOC381139
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84128027-84589725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84562694 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 98 (V98D)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect possibly damaging
Transcript: ENSMUST00000125763
AA Change: V98D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: V98D

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182297
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84561752 missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84562720 nonsense probably null
IGL02110:Zfp407 APN 18 84559040 missense probably benign 0.00
IGL02343:Zfp407 APN 18 84209724 missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84558641 missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84559031 nonsense probably null
IGL02946:Zfp407 APN 18 84560709 missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84350975 missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84209721 missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84560797 missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84209955 missense probably damaging 0.99
PIT4362001:Zfp407 UTSW 18 84561268 missense possibly damaging 0.87
PIT4520001:Zfp407 UTSW 18 84432420 missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84560411 missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84558711 missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84562567 missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R0787:Zfp407 UTSW 18 84209022 missense probably damaging 1.00
R0787:Zfp407 UTSW 18 84209346 missense probably benign 0.00
R1065:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1086:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1165:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1186:Zfp407 UTSW 18 84209448 missense probably benign 0.39
R1203:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1312:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1345:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1385:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1421:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1430:Zfp407 UTSW 18 84209455 missense probably benign 0.18
R1436:Zfp407 UTSW 18 84343071 splice site probably benign
R1498:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1526:Zfp407 UTSW 18 84561033 missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84209638 missense probably benign 0.00
R1594:Zfp407 UTSW 18 84209331 missense probably benign 0.01
R1628:Zfp407 UTSW 18 84354533 missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84562157 missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84559336 missense probably benign 0.01
R1984:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1985:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1986:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R2151:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84209793 missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84559880 missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84558397 nonsense probably null
R3407:Zfp407 UTSW 18 84558872 missense probably benign 0.08
R3432:Zfp407 UTSW 18 84208746 missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84560352 missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84559596 missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84343007 missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84562731 nonsense probably null
R4752:Zfp407 UTSW 18 84562914 missense probably benign 0.01
R4881:Zfp407 UTSW 18 84559703 missense probably benign 0.27
R4936:Zfp407 UTSW 18 84559464 missense probably benign 0.00
R5194:Zfp407 UTSW 18 84561309 missense probably benign 0.05
R5243:Zfp407 UTSW 18 84561091 missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84315926 missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84561137 missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84561044 missense probably benign 0.35
R5739:Zfp407 UTSW 18 84208742 makesense probably null
R5806:Zfp407 UTSW 18 84558614 missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84560524 missense probably benign 0.01
R6187:Zfp407 UTSW 18 84559009 missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84560349 missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84432411 missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84208830 missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84343069 splice site probably null
R6899:Zfp407 UTSW 18 84561434 missense possibly damaging 0.86
R7038:Zfp407 UTSW 18 84561857 missense probably damaging 1.00
R7076:Zfp407 UTSW 18 84558476 missense probably damaging 1.00
R7326:Zfp407 UTSW 18 84559042 missense possibly damaging 0.77
R7397:Zfp407 UTSW 18 84561819 missense possibly damaging 0.59
R7402:Zfp407 UTSW 18 84561536 missense probably benign 0.02
R7783:Zfp407 UTSW 18 84209922 missense possibly damaging 0.69
R7800:Zfp407 UTSW 18 84560675 missense probably damaging 0.99
R7904:Zfp407 UTSW 18 84561256 missense not run
R7942:Zfp407 UTSW 18 84559629 missense probably benign 0.02
R7955:Zfp407 UTSW 18 84559291 missense probably benign 0.02
R7988:Zfp407 UTSW 18 84559400 missense possibly damaging 0.60
R8125:Zfp407 UTSW 18 84561185 missense probably damaging 1.00
R8237:Zfp407 UTSW 18 84560144 missense possibly damaging 0.87
R8364:Zfp407 UTSW 18 84552868 critical splice donor site probably null
R8443:Zfp407 UTSW 18 84209862 missense probably damaging 1.00
RF003:Zfp407 UTSW 18 84209563 missense probably benign 0.17
Z1177:Zfp407 UTSW 18 84209954 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATTGTGTCTTTCAGGAACAAGG -3'
(R):5'- ATCCCGCGATGACAGTTCTG -3'

Sequencing Primer
(F):5'- TTGTGTCTTTCAGGAACAAGGGAAAC -3'
(R):5'- GCCTGTATCTGATGACATGGCAAATG -3'
Posted On2015-07-21