Incidental Mutation 'R4991:Zbtb24'
ID386201
Institutional Source Beutler Lab
Gene Symbol Zbtb24
Ensembl Gene ENSMUSG00000019826
Gene Namezinc finger and BTB domain containing 24
SynonymsZNF450
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4991 (G1)
Quality Score161
Status Validated
Chromosome10
Chromosomal Location41450383-41465574 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 41456618 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797] [ENSMUST00000216656]
Predicted Effect probably null
Transcript: ENSMUST00000080771
SMART Domains Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826

DomainStartEndE-ValueType
BTB 37 133 5.81e-26 SMART
AT_hook 159 171 2.23e-1 SMART
low complexity region 248 260 N/A INTRINSIC
ZnF_C2H2 293 315 8.67e-1 SMART
ZnF_C2H2 321 343 4.87e-4 SMART
ZnF_C2H2 349 371 6.42e-4 SMART
ZnF_C2H2 377 399 2.99e-4 SMART
ZnF_C2H2 405 427 9.44e-2 SMART
ZnF_C2H2 433 455 3.26e-5 SMART
ZnF_C2H2 461 483 2.36e-2 SMART
ZnF_C2H2 489 511 7.9e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215881
Predicted Effect probably benign
Transcript: ENSMUST00000216656
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Zbtb24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Zbtb24 APN 10 41451889 missense possibly damaging 0.63
R0485:Zbtb24 UTSW 10 41464536 missense probably damaging 0.96
R0553:Zbtb24 UTSW 10 41451997 missense possibly damaging 0.78
R0662:Zbtb24 UTSW 10 41462279 missense probably damaging 1.00
R0927:Zbtb24 UTSW 10 41451436 missense probably benign 0.43
R1164:Zbtb24 UTSW 10 41464527 missense probably damaging 1.00
R1456:Zbtb24 UTSW 10 41464993 missense possibly damaging 0.46
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1873:Zbtb24 UTSW 10 41451127 missense probably benign 0.28
R2299:Zbtb24 UTSW 10 41464581 missense probably damaging 1.00
R2371:Zbtb24 UTSW 10 41451268 missense probably damaging 1.00
R4280:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4281:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4593:Zbtb24 UTSW 10 41451957 missense possibly damaging 0.89
R5262:Zbtb24 UTSW 10 41464560 nonsense probably null
R5371:Zbtb24 UTSW 10 41451541 missense probably benign 0.01
R5393:Zbtb24 UTSW 10 41464582 missense probably damaging 1.00
R5428:Zbtb24 UTSW 10 41464788 missense probably benign
R5785:Zbtb24 UTSW 10 41451853 missense probably benign 0.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6961:Zbtb24 UTSW 10 41455175 missense probably damaging 1.00
R7189:Zbtb24 UTSW 10 41464476 missense probably benign 0.00
R7407:Zbtb24 UTSW 10 41464779 missense possibly damaging 0.94
R8074:Zbtb24 UTSW 10 41451232 missense probably damaging 1.00
Z1176:Zbtb24 UTSW 10 41455190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTGCCGCATGTAAAGTG -3'
(R):5'- TGAGGCACAGAACCAGACTG -3'

Sequencing Primer
(F):5'- GCCGCATGTAAAGTGGTTATC -3'
(R):5'- AGACTGGCAGACACCGTG -3'
Posted On2016-05-10