Incidental Mutation 'R5083:Atp2a3'
ID387268
Institutional Source Beutler Lab
Gene Symbol Atp2a3
Ensembl Gene ENSMUSG00000020788
Gene NameATPase, Ca++ transporting, ubiquitous
SynonymsSerca3
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72961169-72993044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72982826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 824 (V824L)
Ref Sequence ENSEMBL: ENSMUSP00000104124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021142] [ENSMUST00000108484] [ENSMUST00000108485] [ENSMUST00000108486] [ENSMUST00000163326]
Predicted Effect probably null
Transcript: ENSMUST00000021142
AA Change: V842L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021142
Gene: ENSMUSG00000020788
AA Change: V842L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 92 340 3.1e-66 PFAM
Pfam:Hydrolase 345 715 5.2e-22 PFAM
Pfam:HAD 348 712 3e-19 PFAM
Pfam:Cation_ATPase 418 528 4.4e-23 PFAM
Pfam:Hydrolase_3 684 747 4.5e-8 PFAM
Pfam:Cation_ATPase_C 784 987 1.8e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108484
AA Change: V824L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104124
Gene: ENSMUSG00000020788
AA Change: V824L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 3.4e-16 SMART
Pfam:E1-E2_ATPase 93 341 8.9e-67 PFAM
Pfam:Hydrolase 345 697 8.1e-27 PFAM
Pfam:HAD 348 694 4.1e-14 PFAM
Pfam:Hydrolase_like2 418 528 2.1e-21 PFAM
Pfam:Hydrolase_3 666 729 2.6e-6 PFAM
transmembrane domain 742 764 N/A INTRINSIC
Pfam:Cation_ATPase_C 766 969 4.2e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108485
AA Change: V842L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104125
Gene: ENSMUSG00000020788
AA Change: V842L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.1e-68 PFAM
Pfam:Hydrolase 345 715 2.7e-33 PFAM
Pfam:HAD 348 712 1.3e-17 PFAM
Pfam:Hydrolase_like2 418 528 2.2e-23 PFAM
Pfam:Hydrolase_3 684 747 1.8e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.6e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108486
AA Change: V824L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104126
Gene: ENSMUSG00000020788
AA Change: V824L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 697 2.8e-28 PFAM
Pfam:HAD 348 694 1.1e-15 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 666 729 5.1e-8 PFAM
Pfam:Cation_ATPase_C 766 969 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135234
Predicted Effect probably null
Transcript: ENSMUST00000163326
AA Change: V842L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127036
Gene: ENSMUSG00000020788
AA Change: V842L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 715 6.5e-33 PFAM
Pfam:HAD 348 712 2.5e-17 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 684 747 5.1e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.5e-48 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced endothelial-dependent relaxation in the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Atp2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Atp2a3 APN 11 72982787 missense probably damaging 0.98
IGL01141:Atp2a3 APN 11 72982665 missense probably damaging 1.00
IGL01949:Atp2a3 APN 11 72981897 missense probably damaging 1.00
IGL02267:Atp2a3 APN 11 72987984 missense probably damaging 1.00
IGL02385:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02390:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02391:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02392:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02487:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02525:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02526:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02527:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02581:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02643:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02644:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02646:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02647:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02649:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02650:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02651:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02667:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02668:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02819:Atp2a3 APN 11 72977207 missense probably damaging 1.00
IGL02888:Atp2a3 APN 11 72977128 splice site probably benign
R0193:Atp2a3 UTSW 11 72972220 missense possibly damaging 0.57
R0357:Atp2a3 UTSW 11 72970931 critical splice donor site probably null
R0376:Atp2a3 UTSW 11 72982702 missense probably damaging 1.00
R0452:Atp2a3 UTSW 11 72977232 splice site probably null
R0494:Atp2a3 UTSW 11 72981905 missense probably damaging 1.00
R0588:Atp2a3 UTSW 11 72973024 missense possibly damaging 0.79
R0674:Atp2a3 UTSW 11 72981885 missense probably damaging 1.00
R1586:Atp2a3 UTSW 11 72991744 missense probably damaging 0.98
R1666:Atp2a3 UTSW 11 72978807 critical splice donor site probably null
R1994:Atp2a3 UTSW 11 72975414 missense probably damaging 0.99
R2087:Atp2a3 UTSW 11 72980448 missense probably damaging 1.00
R4675:Atp2a3 UTSW 11 72981797 missense probably damaging 1.00
R4795:Atp2a3 UTSW 11 72973029 missense probably benign 0.01
R4898:Atp2a3 UTSW 11 72982680 missense probably damaging 1.00
R5174:Atp2a3 UTSW 11 72980215 missense probably damaging 1.00
R5266:Atp2a3 UTSW 11 72975397 missense probably damaging 1.00
R5304:Atp2a3 UTSW 11 72988557 missense probably damaging 0.98
R5802:Atp2a3 UTSW 11 72972882 missense probably damaging 1.00
R6107:Atp2a3 UTSW 11 72988461 critical splice acceptor site probably null
R6157:Atp2a3 UTSW 11 72980616 missense probably damaging 1.00
R6760:Atp2a3 UTSW 11 72982740 missense probably damaging 1.00
R7406:Atp2a3 UTSW 11 72978750 missense probably damaging 1.00
Z1176:Atp2a3 UTSW 11 72980622 missense possibly damaging 0.96
Z1176:Atp2a3 UTSW 11 72989540 missense probably benign
Z1177:Atp2a3 UTSW 11 72980327 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCACAGCAATTCTGGGCCTG -3'
(R):5'- GGCATAGTGACTGATCCAATATGTAC -3'

Sequencing Primer
(F):5'- TGCCCGAAGCTCTGATCC -3'
(R):5'- CTCCAGGTTAGTGAGAGACCTTATC -3'
Posted On2016-06-06