Incidental Mutation 'R5001:Lct'
ID389874
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission 042595-MU
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5001 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128308241 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 343 (L343P)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: L343P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: L343P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 G A 12: 4,198,434 V499M possibly damaging Het
Aff4 T C 11: 53,404,357 S795P probably damaging Het
Ank G A 15: 27,562,733 V176I probably damaging Het
Ankfn1 A G 11: 89,441,442 I446T possibly damaging Het
Arhgap33 C A 7: 30,533,016 S32I possibly damaging Het
Ascc3 T A 10: 50,823,648 Y1856N probably damaging Het
Atf3 T C 1: 191,177,275 T66A probably benign Het
Atf7ip T C 6: 136,561,388 C548R probably damaging Het
Bag6 A G 17: 35,145,176 T841A probably damaging Het
Bbof1 A T 12: 84,426,856 Q320L possibly damaging Het
Bmp2k A T 5: 97,053,142 Q307L probably damaging Het
Btaf1 T A 19: 36,986,652 N874K possibly damaging Het
Calr4 G A 4: 109,238,982 probably null Het
Camk1d T C 2: 5,313,101 I248V possibly damaging Het
Ccdc130 G A 8: 84,258,675 P322S probably benign Het
Ccdc177 G A 12: 80,757,386 R705C unknown Het
Cdk18 C T 1: 132,118,849 probably null Het
Cers4 A G 8: 4,515,565 S4G probably benign Het
Cfap54 A G 10: 92,964,534 V1604A probably benign Het
Chd8 C T 14: 52,203,915 G907S probably benign Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Cntd1 T C 11: 101,285,731 V218A possibly damaging Het
Cog7 A T 7: 121,949,886 V384E probably damaging Het
Col5a2 A G 1: 45,502,898 V6A unknown Het
Col7a1 T C 9: 108,965,078 probably null Het
Cpsf6 T A 10: 117,367,961 I29L possibly damaging Het
Cyp3a13 T C 5: 137,898,916 T379A probably benign Het
Ddx46 T C 13: 55,652,919 S296P probably damaging Het
Dmbt1 A G 7: 131,050,012 D328G probably damaging Het
Dnah8 T G 17: 30,787,185 L3692W probably damaging Het
Dnmt3l A C 10: 78,059,731 S368R probably null Het
Egfr A G 11: 16,904,434 K869E probably damaging Het
Ehd1 G A 19: 6,297,694 M359I probably benign Het
F5 A T 1: 164,195,570 T1566S probably benign Het
Fam207a A G 10: 77,490,016 V154A probably benign Het
Flrt2 T C 12: 95,778,951 I21T probably benign Het
Galnt1 T A 18: 24,271,755 I383K probably benign Het
Ghdc G T 11: 100,766,834 A523D probably damaging Het
Gm24022 A G 12: 113,429,779 probably benign Het
Golga3 T C 5: 110,205,777 S934P probably damaging Het
Gpr135 T A 12: 72,070,508 T162S probably benign Het
Gucd1 G A 10: 75,517,202 probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ick T C 9: 78,131,519 S17P probably damaging Het
Igkv6-15 T C 6: 70,406,649 Y56C probably damaging Het
Il22ra1 A T 4: 135,733,104 Y57F probably damaging Het
Irak4 A G 15: 94,558,273 E247G possibly damaging Het
Kank3 T C 17: 33,821,772 V13A possibly damaging Het
Klhl1 A T 14: 96,136,610 S667T probably damaging Het
Klhl6 T G 16: 19,946,991 *620C probably null Het
Lgr6 G T 1: 134,990,632 P264T probably benign Het
Lilrb4a T A 10: 51,491,420 probably null Het
Lin7a G T 10: 107,382,669 G25* probably null Het
Lmnb2 G A 10: 80,918,112 T36M probably damaging Het
Manba T C 3: 135,567,630 F775S probably benign Het
March6 A G 15: 31,465,322 V812A probably damaging Het
Megf6 T A 4: 154,268,060 L1292H probably damaging Het
Myo18b T G 5: 112,761,340 Q1979P probably damaging Het
Myoz1 T C 14: 20,653,701 M59V probably damaging Het
Naa35 T C 13: 59,625,531 I100T possibly damaging Het
Nox4 A T 7: 87,360,803 Y404F probably damaging Het
Ntn1 T C 11: 68,260,532 Y441C probably damaging Het
Olfr1329 C A 4: 118,917,243 V75F probably damaging Het
Olfr351 T C 2: 36,860,070 T93A probably benign Het
Olfr984 G A 9: 40,101,227 H88Y probably benign Het
Onecut3 A G 10: 80,495,320 T105A unknown Het
Pabpc1l A G 2: 164,042,518 S392G probably benign Het
Pan3 T A 5: 147,526,682 probably null Het
Pcdha4 G A 18: 36,954,948 S728N probably benign Het
Pds5a T C 5: 65,696,785 D38G probably damaging Het
Pgm2l1 A G 7: 100,272,376 I605V probably benign Het
Phip T C 9: 82,896,019 probably null Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Ppp2r2a A T 14: 67,022,308 L313* probably null Het
Ppp4c A G 7: 126,787,537 F126S probably damaging Het
Ptger2 C A 14: 44,989,367 R135S probably damaging Het
Rab11fip5 T A 6: 85,347,806 E506D probably damaging Het
Rdh12 G A 12: 79,212,742 G133R probably damaging Het
Rims2 A T 15: 39,452,428 D610V probably benign Het
Saa1 T A 7: 46,740,708 Y122F probably damaging Het
Sept10 A T 10: 59,176,989 V269E probably damaging Het
Serpina3n T A 12: 104,408,739 D23E probably benign Het
Serpinb11 A G 1: 107,376,868 K188E possibly damaging Het
Slc18a3 C T 14: 32,463,779 V216M possibly damaging Het
Slc19a3 G T 1: 83,022,620 N225K probably benign Het
Slc4a1 T A 11: 102,351,503 I797F probably benign Het
Spic A G 10: 88,675,899 M165T possibly damaging Het
Timm44 A T 8: 4,275,886 M1K probably null Het
Tmc6 A G 11: 117,770,784 L572P probably benign Het
Tnc G A 4: 63,984,489 T1517I probably damaging Het
Tnc G A 4: 64,000,062 T1204M probably benign Het
Trip11 A T 12: 101,884,910 L680* probably null Het
Trps1 T A 15: 50,661,307 M887L possibly damaging Het
Tulp3 A C 6: 128,325,068 V330G probably damaging Het
Upf1 A G 8: 70,334,700 S835P probably damaging Het
Wdr64 A G 1: 175,792,959 probably null Het
Zbtb40 A G 4: 136,996,150 L643P probably damaging Het
Zc3h18 A T 8: 122,383,520 D36V probably damaging Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
R7577:Lct UTSW 1 128300732 missense probably damaging 0.99
R7626:Lct UTSW 1 128285195 missense probably damaging 1.00
R7737:Lct UTSW 1 128298693 missense probably benign 0.12
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCACGTTAAAGGCTCCC -3'
(R):5'- GCCTTTGGTGTGTAGCTAAAAG -3'

Sequencing Primer
(F):5'- TTAAAGGCTCCCGTGGATAC -3'
(R):5'- GGCCTGGAACTCACTATGTAGAC -3'
Posted On2016-06-06