Mutagenetix > Incidental Mutations

Incidental Mutation 'R7577:Lct'

586465

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7577 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 128300732 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1008 (D1008A)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073490
AA Change: D1008A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: D1008A

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	T	10: 79,066,491	V664M	possibly damaging	Het
4931423N10Rik	A	G	2: 23,207,825	Y5C	probably benign	Het
9530053A07Rik	A	G	7: 28,154,423	D1604G	possibly damaging	Het
Abca4	A	G	3: 122,174,014	T2238A	probably damaging	Het
Adss	G	A	1: 177,767,697	Q426*	probably null	Het
Afap1l2	T	C	19: 56,944,767	E71G	probably damaging	Het
Afg1l	T	C	10: 42,318,611	D395G	probably damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Alms1	A	G	6: 85,615,320	T385A	probably benign	Het
Ank3	C	T	10: 69,992,572	T2357I		Het
Ankfn1	T	A	11: 89,503,971	S263C	probably benign	Het
Azin1	C	T	15: 38,501,421	V29I	probably benign	Het
B3galt2	T	C	1: 143,647,304	Y393H	probably damaging	Het
Cnbd2	G	T	2: 156,328,376	R127L	possibly damaging	Het
Col6a5	A	T	9: 105,864,688	L2344*	probably null	Het
Csn3	T	C	5: 87,929,962	V109A	not run	Het
Cxcr2	C	G	1: 74,158,915	N189K	probably benign	Het
Dclre1a	A	G	19: 56,529,533	F1038S	probably damaging	Het
Ddx21	T	C	10: 62,590,670	Q468R	probably benign	Het
Dlx6	A	G	6: 6,863,423	D15G	probably damaging	Het
Dnajb14	T	C	3: 137,904,797	V262A	possibly damaging	Het
Dpp7	A	G	2: 25,355,591	V161A	probably benign	Het
Enkur	C	T	2: 21,205,102	S16N	probably benign	Het
Ensa	C	A	3: 95,628,645	H96Q	probably damaging	Het
Ero1lb	T	G	13: 12,602,365	C393G	probably damaging	Het
Fam129a	T	A	1: 151,718,312	V916E	probably benign	Het
Fam173b	C	T	15: 31,606,040	A48V	probably damaging	Het
Fbxo3	T	C	2: 104,051,198	F292L	possibly damaging	Het
Fos	T	C	12: 85,475,097	S102P	probably benign	Het
Foxs1	C	T	2: 152,932,441	G231S	probably benign	Het
Furin	T	C	7: 80,396,986	D174G	probably damaging	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Gm32687	T	A	10: 81,880,189	C472S	probably damaging	Het
Gmip	A	G	8: 69,814,435	E327G	probably benign	Het
Gpld1	A	G	13: 24,962,405	T211A	probably benign	Het
Grin2d	T	C	7: 45,862,379	H214R	probably benign	Het
Hfm1	T	C	5: 106,896,043	T576A	probably benign	Het
Hnrnpd	A	T	5: 99,967,254	F142I	probably damaging	Het
Krt32	T	A	11: 100,081,221	T434S	probably benign	Het
Man1c1	A	G	4: 134,564,503		probably null	Het
March7	T	A	2: 60,229,704	C58*	probably null	Het
Mccc1	C	T	3: 35,975,794		probably null	Het
Mybpc1	T	A	10: 88,549,325	D484V	probably damaging	Het
Myh10	T	A	11: 68,745,980	C227S	unknown	Het
Nin	T	C	12: 70,062,706	E153G		Het
Nr1h2	G	A	7: 44,550,792	T313M	probably damaging	Het
Olfr1288	T	A	2: 111,479,132	I116K	probably damaging	Het
Olfr178	G	T	16: 58,889,266	A318D	probably benign	Het
Otog	C	A	7: 46,287,855	H1663N	possibly damaging	Het
Piezo2	G	T	18: 63,053,010	T1696K	probably benign	Het
Plcd1	A	T	9: 119,072,254	N703K	possibly damaging	Het
Plekhg4	T	A	8: 105,375,399	C7S	probably benign	Het
Pnma2	A	G	14: 66,915,979		probably benign	Het
Prag1	A	G	8: 36,146,942	Y1216C	probably damaging	Het
Prima1	T	C	12: 103,197,307	Y135C	probably damaging	Het
Prkce	C	A	17: 86,493,293	S379*	probably null	Het
Prmt7	A	G	8: 106,242,203	N383S	probably damaging	Het
Ptafr	A	G	4: 132,579,752	Y151C	probably damaging	Het
Ptprn2	T	C	12: 116,485,866	M1T	probably null	Het
Rad23a	A	T	8: 84,838,479	S136T	probably benign	Het
Rnf123	A	T	9: 108,070,619	Y137N	probably damaging	Het
Sfxn4	A	C	19: 60,853,886	I126S	probably benign	Het
Slc4a4	A	G	5: 89,225,867	H935R	probably damaging	Het
Slitrk3	T	G	3: 73,051,115	N108T	probably damaging	Het
Spred1	T	A	2: 117,177,325	H237Q	probably benign	Het
Syne1	T	A	10: 5,124,820	K1168N	probably damaging	Het
Syt14	T	C	1: 192,983,577	K340E	unknown	Het
Tespa1	T	C	10: 130,354,755	S84P	probably damaging	Het
Tmem268	G	T	4: 63,562,444		probably benign	Het
Tmem52b	T	A	6: 129,516,077	Y48*	probably null	Het
Tox2	C	A	2: 163,315,902	Y295*	probably null	Het
Trp53bp1	T	G	2: 121,236,638	T536P	possibly damaging	Het
Tysnd1	T	C	10: 61,695,886	C106R	probably benign	Het
Unc5d	T	C	8: 28,891,421	I63V	probably damaging	Het
Vmn1r235	A	G	17: 21,261,619	N69D	possibly damaging	Het
Vps11	A	T	9: 44,348,961	M868K	probably benign	Het
Wipf3	A	G	6: 54,485,524	T240A	possibly damaging	Het
Xirp2	G	A	2: 67,514,965	E2517K	possibly damaging	Het
Ylpm1	T	A	12: 84,997,220	L244Q	unknown	Het
Zdhhc18	G	T	4: 133,615,209	S198*	probably null	Het
Zfp760	T	A	17: 21,722,261	L139*	probably null	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0179:Lct	UTSW	1	128327685	missense	probably benign
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128286609	missense	probably benign	0.00
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128300514	missense	probably benign
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R4776:Lct	UTSW	1	128300387	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128304237	missense	probably benign	0.01
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7626:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128298693	missense	probably benign	0.12
R7901:Lct	UTSW	1	128288985	missense	probably benign	0.44
R7984:Lct	UTSW	1	128288985	missense	probably benign	0.44
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTAGCCTAACACTGCAGAAC -3'
(R):5'- GTGTGAAAGACAATGCCACG -3'

Sequencing Primer
(F):5'- AGGCTCATTAAAGGTCATCCAG -3'
(R):5'- TGCCACGGGAGACATAGC -3'

Posted On

2019-10-24