Incidental Mutation 'R5147:Tssk4'
ID 395170
Institutional Source Beutler Lab
Gene Symbol Tssk4
Ensembl Gene ENSMUSG00000007591
Gene Name testis-specific serine kinase 4
Synonyms 4933424F08Rik, 1700020B19Rik
MMRRC Submission 042731-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.620) question?
Stock # R5147 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 55887641-55889996 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55888430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000154232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007735] [ENSMUST00000164809] [ENSMUST00000226497] [ENSMUST00000226591] [ENSMUST00000227297] [ENSMUST00000228041] [ENSMUST00000228395]
AlphaFold Q9D411
Predicted Effect possibly damaging
Transcript: ENSMUST00000007735
AA Change: I100V

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007735
Gene: ENSMUSG00000007591
AA Change: I100V

DomainStartEndE-ValueType
Pfam:Pkinase 25 280 1.1e-54 PFAM
Pfam:Pkinase_Tyr 25 280 7.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164809
AA Change: I100V

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127728
Gene: ENSMUSG00000007591
AA Change: I100V

DomainStartEndE-ValueType
Pfam:Pkinase 25 281 4e-56 PFAM
Pfam:Pkinase_Tyr 25 281 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226497
AA Change: I100V

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000226591
AA Change: I100V

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227297
AA Change: I100V

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228007
Predicted Effect probably benign
Transcript: ENSMUST00000228041
AA Change: I100V

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228395
AA Change: I100V

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,851,149 (GRCm39) Y2121H probably benign Het
Adgrf2 A G 17: 43,021,574 (GRCm39) Y417H probably damaging Het
Ap5z1 A C 5: 142,452,265 (GRCm39) D66A probably benign Het
Cachd1 T A 4: 100,821,688 (GRCm39) Y422N probably damaging Het
Cfap54 C T 10: 92,773,700 (GRCm39) G114D probably benign Het
Cgref1 C T 5: 31,091,049 (GRCm39) G255E probably benign Het
Cyp2a22 A C 7: 26,635,750 (GRCm39) L271R probably damaging Het
Dcp2 G T 18: 44,550,662 (GRCm39) E379* probably null Het
Fhl3 T A 4: 124,601,724 (GRCm39) D277E probably benign Het
Gm19684 C T 17: 36,439,411 (GRCm39) V190M probably damaging Het
Hpse T C 5: 100,867,375 (GRCm39) D29G probably benign Het
Il31 T C 5: 123,620,121 (GRCm39) probably benign Het
Ilk T C 7: 105,391,774 (GRCm39) C422R possibly damaging Het
Itga1 T G 13: 115,121,678 (GRCm39) D777A possibly damaging Het
Kank3 A G 17: 34,041,176 (GRCm39) D556G probably damaging Het
Lrit3 A G 3: 129,597,574 (GRCm39) S36P possibly damaging Het
Magi1 C T 6: 93,724,248 (GRCm39) E256K probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
Mymk C T 2: 26,952,299 (GRCm39) M148I probably benign Het
Nlrp12 T A 7: 3,290,003 (GRCm39) I170F possibly damaging Het
Odad3 T C 9: 21,906,158 (GRCm39) E260G probably benign Het
Or5al7 A T 2: 85,992,378 (GRCm39) I305K possibly damaging Het
Or5an11 T A 19: 12,246,268 (GRCm39) S225T probably damaging Het
Pkd1l1 G A 11: 8,799,003 (GRCm39) T1803I possibly damaging Het
Ppp2r2b C T 18: 42,778,942 (GRCm39) V398I probably benign Het
Ppp2r5e T A 12: 75,516,544 (GRCm39) R214S probably damaging Het
Prss16 T C 13: 22,190,264 (GRCm39) D298G possibly damaging Het
Qprt G A 7: 126,707,622 (GRCm39) R189W probably damaging Het
Rara C T 11: 98,841,550 (GRCm39) S36F probably benign Het
Rasal2 A G 1: 157,003,264 (GRCm39) V465A probably damaging Het
Slc22a1 C T 17: 12,869,838 (GRCm39) G508R probably damaging Het
Slco2a1 C A 9: 102,927,468 (GRCm39) F120L probably damaging Het
Tex15 T A 8: 34,062,340 (GRCm39) L864* probably null Het
Vgll4 A G 6: 114,867,576 (GRCm39) probably null Het
Vmn1r65 T G 7: 6,011,818 (GRCm39) I139L probably benign Het
Vps13b C T 15: 35,456,824 (GRCm39) P757S probably benign Het
Ythdc2 G A 18: 44,977,359 (GRCm39) G385E probably damaging Het
Other mutations in Tssk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Tssk4 APN 14 55,888,010 (GRCm39) missense probably damaging 1.00
IGL02943:Tssk4 APN 14 55,889,023 (GRCm39) missense probably damaging 1.00
IGL03082:Tssk4 APN 14 55,888,518 (GRCm39) missense probably damaging 1.00
IGL03281:Tssk4 APN 14 55,887,885 (GRCm39) missense possibly damaging 0.86
R0201:Tssk4 UTSW 14 55,889,017 (GRCm39) missense probably damaging 1.00
R0201:Tssk4 UTSW 14 55,889,016 (GRCm39) nonsense probably null
R1655:Tssk4 UTSW 14 55,889,152 (GRCm39) missense probably damaging 1.00
R1660:Tssk4 UTSW 14 55,888,029 (GRCm39) missense probably null 0.90
R1743:Tssk4 UTSW 14 55,888,488 (GRCm39) missense probably damaging 1.00
R2103:Tssk4 UTSW 14 55,888,997 (GRCm39) missense probably damaging 1.00
R3431:Tssk4 UTSW 14 55,889,152 (GRCm39) missense probably damaging 1.00
R3432:Tssk4 UTSW 14 55,889,152 (GRCm39) missense probably damaging 1.00
R4113:Tssk4 UTSW 14 55,887,830 (GRCm39) missense probably benign 0.00
R4870:Tssk4 UTSW 14 55,889,272 (GRCm39) missense probably benign 0.38
R4957:Tssk4 UTSW 14 55,889,266 (GRCm39) missense probably damaging 1.00
R6785:Tssk4 UTSW 14 55,887,932 (GRCm39) missense probably damaging 1.00
R6917:Tssk4 UTSW 14 55,889,864 (GRCm39) missense probably benign 0.13
R7748:Tssk4 UTSW 14 55,888,569 (GRCm39) missense probably damaging 1.00
R9043:Tssk4 UTSW 14 55,889,211 (GRCm39) missense probably damaging 0.99
R9189:Tssk4 UTSW 14 55,887,904 (GRCm39) missense probably benign 0.00
Z1088:Tssk4 UTSW 14 55,888,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAATATTCAGCTCACTATCC -3'
(R):5'- TTAAGATTCCCAAAGCCCAGTC -3'

Sequencing Primer
(F):5'- AATATTCAGCTCACTATCCAATGTCC -3'
(R):5'- AAAGCCCAGTCCGGTGAC -3'
Posted On 2016-06-21