Incidental Mutation 'R5147:Rara'
ID395165
Institutional Source Beutler Lab
Gene Symbol Rara
Ensembl Gene ENSMUSG00000037992
Gene Nameretinoic acid receptor, alpha
SynonymsRAR alpha 1, RARalpha1
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98927818-98974942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98950724 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 36 (S36F)
Ref Sequence ENSEMBL: ENSMUSP00000129791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068133] [ENSMUST00000107474] [ENSMUST00000107475] [ENSMUST00000164748]
Predicted Effect probably benign
Transcript: ENSMUST00000068133
AA Change: S36F

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069744
Gene: ENSMUSG00000037992
AA Change: S36F

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082557
Predicted Effect probably benign
Transcript: ENSMUST00000107474
AA Change: S36F

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103098
Gene: ENSMUSG00000037992
AA Change: S36F

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107475
AA Change: S36F

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103099
Gene: ENSMUSG00000037992
AA Change: S36F

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147985
Predicted Effect probably benign
Transcript: ENSMUST00000164748
AA Change: S36F

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129791
Gene: ENSMUSG00000037992
AA Change: S36F

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for targeted null mutations show high neonatal mortality due to maternal cannibalization, failure to thrive, and excess mortality during the postnatal period. Male survivors exhibit testicular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Rara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Rara APN 11 98968166 missense probably benign 0.00
IGL01155:Rara APN 11 98968184 missense possibly damaging 0.92
IGL02141:Rara APN 11 98968081 missense probably damaging 1.00
IGL03194:Rara APN 11 98971664 missense possibly damaging 0.96
PIT4486001:Rara UTSW 11 98973495 missense possibly damaging 0.88
R0626:Rara UTSW 11 98971580 critical splice acceptor site probably null
R1973:Rara UTSW 11 98971670 missense possibly damaging 0.91
R3975:Rara UTSW 11 98970569 missense probably damaging 1.00
R4357:Rara UTSW 11 98968111 missense probably damaging 0.98
R5102:Rara UTSW 11 98966359 missense possibly damaging 0.80
R5381:Rara UTSW 11 98971584 missense possibly damaging 0.93
R5570:Rara UTSW 11 98972652 missense probably damaging 1.00
R5861:Rara UTSW 11 98968161 nonsense probably null
R6273:Rara UTSW 11 98970222 missense probably benign 0.00
R6404:Rara UTSW 11 98961013 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGAAGGCCATCACAACTACCTG -3'
(R):5'- AAACGGACCATCTTCAGGTCC -3'

Sequencing Primer
(F):5'- ACAACTACCTGCCAGACTGTTTG -3'
(R):5'- ACAATGGTCACCCTGGTCTAG -3'
Posted On2016-06-21