Incidental Mutation 'R5147:Fhl3'
ID395145
Institutional Source Beutler Lab
Gene Symbol Fhl3
Ensembl Gene ENSMUSG00000032643
Gene Namefour and a half LIM domains 3
Synonyms
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location124700701-124708611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124707931 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 277 (D277E)
Ref Sequence ENSEMBL: ENSMUSP00000040150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038684] [ENSMUST00000106199] [ENSMUST00000145942]
Predicted Effect probably benign
Transcript: ENSMUST00000038684
AA Change: D277E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000040150
Gene: ENSMUSG00000032643
AA Change: D277E

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 284 2.91e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106199
AA Change: D268E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101805
Gene: ENSMUSG00000032643
AA Change: D268E

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 275 8.49e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145942
SMART Domains Protein: ENSMUSP00000121702
Gene: ENSMUSG00000032643

DomainStartEndE-ValueType
Blast:LIM 1 31 5e-6 BLAST
LIM 39 92 2.7e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Fhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0592:Fhl3 UTSW 4 124705677 missense probably benign 0.23
R1118:Fhl3 UTSW 4 124705791 critical splice donor site probably null
R2402:Fhl3 UTSW 4 124705688 missense probably damaging 1.00
R2921:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R2923:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R4583:Fhl3 UTSW 4 124707549 missense probably benign 0.41
R5460:Fhl3 UTSW 4 124706003 missense probably damaging 1.00
R5932:Fhl3 UTSW 4 124705727 missense probably damaging 1.00
R6855:Fhl3 UTSW 4 124707522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCAGGTAAGAGTTCGGATG -3'
(R):5'- CCACTGGGGTGTGTTAAAATTG -3'

Sequencing Primer
(F):5'- TTCGGATGTAACACGGGTGAG -3'
(R):5'- CTGAATCCTGAAGTCCCAATGAGTG -3'
Posted On2016-06-21