Incidental Mutation 'R5147:Cyp2a22'
ID395154
Institutional Source Beutler Lab
Gene Symbol Cyp2a22
Ensembl Gene ENSMUSG00000091867
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 22
SynonymsEG233005
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26931631-26939384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26936325 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 271 (L271R)
Ref Sequence ENSEMBL: ENSMUSP00000128030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170227]
Predicted Effect probably damaging
Transcript: ENSMUST00000170227
AA Change: L271R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128030
Gene: ENSMUSG00000091867
AA Change: L271R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.4e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Cyp2a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cyp2a22 APN 7 26937738 missense probably benign 0.09
IGL01111:Cyp2a22 APN 7 26936458 missense probably damaging 1.00
IGL01388:Cyp2a22 APN 7 26937792 missense probably benign 0.02
IGL01449:Cyp2a22 APN 7 26933553 missense probably benign 0.01
IGL01642:Cyp2a22 APN 7 26938759 missense possibly damaging 0.81
IGL02253:Cyp2a22 APN 7 26938237 splice site probably benign
IGL02327:Cyp2a22 APN 7 26934781 missense probably damaging 0.99
IGL02673:Cyp2a22 APN 7 26938100 missense probably benign 0.00
IGL02813:Cyp2a22 APN 7 26936434 missense probably benign 0.19
IGL02896:Cyp2a22 APN 7 26936461 missense probably damaging 0.98
IGL03193:Cyp2a22 APN 7 26936421 missense probably benign 0.00
IGL03350:Cyp2a22 APN 7 26934854 missense possibly damaging 0.88
R1648:Cyp2a22 UTSW 7 26932368 missense probably damaging 0.98
R1679:Cyp2a22 UTSW 7 26936311 nonsense probably null
R1733:Cyp2a22 UTSW 7 26934762 missense possibly damaging 0.78
R2001:Cyp2a22 UTSW 7 26934772 missense probably damaging 1.00
R2858:Cyp2a22 UTSW 7 26934262 missense probably damaging 0.99
R3054:Cyp2a22 UTSW 7 26938829 missense probably damaging 1.00
R4528:Cyp2a22 UTSW 7 26934769 missense possibly damaging 0.95
R4623:Cyp2a22 UTSW 7 26933491 missense probably damaging 1.00
R4669:Cyp2a22 UTSW 7 26937855 missense possibly damaging 0.88
R4690:Cyp2a22 UTSW 7 26939209 nonsense probably null
R4840:Cyp2a22 UTSW 7 26932524 missense probably benign 0.13
R4915:Cyp2a22 UTSW 7 26937770 missense probably benign 0.33
R5071:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5072:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5074:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5363:Cyp2a22 UTSW 7 26936433 missense probably damaging 0.99
R5705:Cyp2a22 UTSW 7 26939215 missense probably benign 0.05
R6014:Cyp2a22 UTSW 7 26939180 splice site probably null
R6042:Cyp2a22 UTSW 7 26934239 missense probably damaging 1.00
R6253:Cyp2a22 UTSW 7 26934232 missense probably benign 0.18
R6757:Cyp2a22 UTSW 7 26939204 missense probably benign 0.00
R6994:Cyp2a22 UTSW 7 26939181 critical splice donor site probably null
R7581:Cyp2a22 UTSW 7 26938148 missense possibly damaging 0.87
R8212:Cyp2a22 UTSW 7 26937780 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCCATACGCTGGCTTACATAAGG -3'
(R):5'- CTGGGTGTTGCTACTGACAC -3'

Sequencing Primer
(F):5'- CTGGCTTACATAAGGAAGGCTC -3'
(R):5'- GGTGTTGCTACTGACACGTCTC -3'
Posted On2016-06-21