Incidental Mutation 'R5165:Cdhr4'
ID395656
Institutional Source Beutler Lab
Gene Symbol Cdhr4
Ensembl Gene ENSMUSG00000032595
Gene Namecadherin-related family member 4
SynonymsCdh29, 1700021K14Rik, D330022A01Rik
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107992497-107999684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107997630 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 633 (L633P)
Ref Sequence ENSEMBL: ENSMUSP00000135184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000164395] [ENSMUST00000175759] [ENSMUST00000176306] [ENSMUST00000176356] [ENSMUST00000177508] [ENSMUST00000177173] [ENSMUST00000177368] [ENSMUST00000176373]
Predicted Effect probably benign
Transcript: ENSMUST00000035214
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035215
Predicted Effect probably benign
Transcript: ENSMUST00000164395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175729
Predicted Effect probably benign
Transcript: ENSMUST00000175759
SMART Domains Protein: ENSMUSP00000135743
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 3 104 4e-44 BLAST
SCOP:d1l3wa3 59 104 4e-7 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175802
SMART Domains Protein: ENSMUSP00000135003
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
CA 33 116 5.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176196
Predicted Effect probably benign
Transcript: ENSMUST00000176306
Predicted Effect unknown
Transcript: ENSMUST00000176334
AA Change: L58P
Predicted Effect probably benign
Transcript: ENSMUST00000176356
Predicted Effect probably damaging
Transcript: ENSMUST00000177508
AA Change: L13P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135332
Gene: ENSMUSG00000032595
AA Change: L13P

DomainStartEndE-ValueType
Blast:CA 1 29 4e-7 BLAST
transmembrane domain 60 82 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177173
AA Change: L633P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135184
Gene: ENSMUSG00000032595
AA Change: L633P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Blast:CA 149 224 2e-9 BLAST
Blast:CA 252 330 3e-33 BLAST
CA 354 437 2.24e-1 SMART
CA 459 542 5.86e-17 SMART
Blast:CA 566 649 3e-40 BLAST
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176459
Predicted Effect probably benign
Transcript: ENSMUST00000176373
SMART Domains Protein: ENSMUSP00000134896
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Meta Mutation Damage Score 0.1788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Cdhr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdhr4 APN 9 107999545 missense probably damaging 1.00
IGL01105:Cdhr4 APN 9 107995861 unclassified probably benign
IGL02097:Cdhr4 APN 9 107993000 missense probably benign 0.17
IGL02441:Cdhr4 APN 9 107993267 missense possibly damaging 0.84
IGL02635:Cdhr4 APN 9 107992871 missense probably benign 0.04
IGL02870:Cdhr4 APN 9 107998064 critical splice donor site probably null
IGL03160:Cdhr4 APN 9 107995869 missense probably benign 0.05
IGL03162:Cdhr4 APN 9 107998011 missense probably damaging 1.00
IGL03250:Cdhr4 APN 9 107996659 missense probably damaging 0.99
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R1241:Cdhr4 UTSW 9 107995296 missense probably benign 0.00
R1250:Cdhr4 UTSW 9 107997516 missense probably damaging 1.00
R2102:Cdhr4 UTSW 9 107998007 missense probably damaging 1.00
R2104:Cdhr4 UTSW 9 107996261 missense probably damaging 0.97
R2106:Cdhr4 UTSW 9 107997494 missense possibly damaging 0.75
R2108:Cdhr4 UTSW 9 107997644 missense probably damaging 1.00
R2171:Cdhr4 UTSW 9 107992918 missense probably benign 0.00
R2312:Cdhr4 UTSW 9 107995287 missense probably benign 0.00
R4106:Cdhr4 UTSW 9 107996260 missense probably damaging 1.00
R4515:Cdhr4 UTSW 9 107992951 missense probably benign 0.31
R4686:Cdhr4 UTSW 9 107995684 missense probably benign 0.00
R4799:Cdhr4 UTSW 9 107998699 splice site probably benign
R5478:Cdhr4 UTSW 9 107995591 missense possibly damaging 0.61
R5574:Cdhr4 UTSW 9 107993328 unclassified probably benign
R7387:Cdhr4 UTSW 9 107996912 nonsense probably null
R7609:Cdhr4 UTSW 9 107997283 missense probably damaging 0.99
R7663:Cdhr4 UTSW 9 107998772 nonsense probably null
R8141:Cdhr4 UTSW 9 107996792 missense
R8483:Cdhr4 UTSW 9 107994999 missense probably damaging 1.00
R8493:Cdhr4 UTSW 9 107996254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCACTAAGCTGTTGGAG -3'
(R):5'- TGGCAACCCAGCTTTCAAATTC -3'

Sequencing Primer
(F):5'- TCACTAAGCTGTTGGAGAGAGTC -3'
(R):5'- CAGCTTTCAAATTCCCTATGGAGTGG -3'
Posted On2016-06-21