Incidental Mutation 'R5165:Alas1'
ID395655
Institutional Source Beutler Lab
Gene Symbol Alas1
Ensembl Gene ENSMUSG00000032786
Gene Nameaminolevulinic acid synthase 1
Synonymssuccinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N, 5-aminolevulinate synthase
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106233455-106248654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106241255 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 223 (T223A)
Ref Sequence ENSEMBL: ENSMUSP00000151891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074082] [ENSMUST00000112524] [ENSMUST00000133617] [ENSMUST00000141118] [ENSMUST00000143125] [ENSMUST00000214989] [ENSMUST00000215222] [ENSMUST00000219129]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074082
AA Change: T223A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073725
Gene: ENSMUSG00000032786
AA Change: T223A

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 81 1.1e-21 PFAM
Pfam:Preseq_ALAS 73 141 2.8e-12 PFAM
Pfam:Aminotran_1_2 245 591 2.1e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112524
AA Change: T223A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108143
Gene: ENSMUSG00000032786
AA Change: T223A

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 2 140 1.3e-49 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Cys_Met_Meta_PP 283 423 1.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123601
Predicted Effect probably benign
Transcript: ENSMUST00000133617
SMART Domains Protein: ENSMUSP00000122117
Gene: ENSMUSG00000032786

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 79 3.1e-22 PFAM
Pfam:Preseq_ALAS 73 141 8.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134053
Predicted Effect possibly damaging
Transcript: ENSMUST00000141118
AA Change: T223A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117014
Gene: ENSMUSG00000032786
AA Change: T223A

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 81 1.7e-20 PFAM
Pfam:Preseq_ALAS 73 141 4.2e-11 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Aminotran_5 257 422 3.4e-6 PFAM
Pfam:Cys_Met_Meta_PP 285 423 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143125
SMART Domains Protein: ENSMUSP00000119968
Gene: ENSMUSG00000032786

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 61 7.7e-7 PFAM
Pfam:Aminotran_1_2 1 93 2.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214249
Predicted Effect probably benign
Transcript: ENSMUST00000214989
Predicted Effect probably benign
Transcript: ENSMUST00000215222
Predicted Effect probably damaging
Transcript: ENSMUST00000219129
AA Change: T223A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219340
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Alas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Alas1 APN 9 106236472 missense probably benign 0.17
IGL02165:Alas1 APN 9 106238783 missense probably damaging 1.00
IGL02355:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02362:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02499:Alas1 APN 9 106241321 missense probably damaging 1.00
IGL02606:Alas1 APN 9 106241110 unclassified probably benign
IGL03121:Alas1 APN 9 106246914 missense probably damaging 0.99
R0115:Alas1 UTSW 9 106238252 splice site probably null
R0294:Alas1 UTSW 9 106241256 missense probably damaging 1.00
R0333:Alas1 UTSW 9 106241281 missense probably benign 0.08
R0346:Alas1 UTSW 9 106243351 missense possibly damaging 0.78
R1700:Alas1 UTSW 9 106239646 missense possibly damaging 0.46
R1982:Alas1 UTSW 9 106238185 missense probably damaging 1.00
R2056:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2058:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2059:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2355:Alas1 UTSW 9 106236474 missense probably damaging 0.96
R2516:Alas1 UTSW 9 106238660 missense probably damaging 1.00
R3896:Alas1 UTSW 9 106241801 splice site probably null
R4091:Alas1 UTSW 9 106241801 splice site probably null
R4093:Alas1 UTSW 9 106241801 splice site probably null
R4095:Alas1 UTSW 9 106241801 splice site probably null
R4673:Alas1 UTSW 9 106236477 missense probably damaging 1.00
R4948:Alas1 UTSW 9 106246878 nonsense probably null
R5215:Alas1 UTSW 9 106243375 missense probably benign 0.05
R5420:Alas1 UTSW 9 106234159 missense probably benign 0.13
R5993:Alas1 UTSW 9 106234129 missense probably benign 0.11
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R7489:Alas1 UTSW 9 106241634 critical splice donor site probably null
R7726:Alas1 UTSW 9 106246951 missense probably benign 0.00
R8012:Alas1 UTSW 9 106246763 missense probably benign
R8036:Alas1 UTSW 9 106235522 missense probably benign 0.19
R8353:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
R8453:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
Z1176:Alas1 UTSW 9 106238769 missense probably benign 0.42
Z1176:Alas1 UTSW 9 106243367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCTGCCAAATAACGCCTG -3'
(R):5'- GTGTGCCACACATTCTAGTCC -3'

Sequencing Primer
(F):5'- CTGCCAAATAACGCCTGTGGTAG -3'
(R):5'- GTTTGTTTGCACTTCAGCT -3'
Posted On2016-06-21