Incidental Mutation 'R5141:Sptbn5'
ID396442
Institutional Source Beutler Lab
Gene Symbol Sptbn5
Ensembl Gene ENSMUSG00000074899
Gene Namespectrin beta, non-erythrocytic 5
SynonymsEG640524, Spnb5
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120046157-120085772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120061731 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1083 (S1083F)
Ref Sequence ENSEMBL: ENSMUSP00000106384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110756]
Predicted Effect probably benign
Transcript: ENSMUST00000110756
AA Change: S1083F

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106384
Gene: ENSMUSG00000074899
AA Change: S1083F

DomainStartEndE-ValueType
SPEC 13 111 6.45e-8 SMART
Blast:SPEC 117 206 9e-12 BLAST
SPEC 219 323 3.76e-1 SMART
SPEC 325 425 3.48e-13 SMART
SPEC 431 530 1.09e-5 SMART
SPEC 536 631 1.22e-1 SMART
SPEC 637 737 1.78e-10 SMART
SPEC 743 837 4.73e-15 SMART
SPEC 843 944 4.24e-17 SMART
SPEC 950 1051 1.36e-15 SMART
Blast:SPEC 1057 1130 2e-40 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Sptbn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sptbn5 APN 2 120054467 unclassified probably benign
IGL01552:Sptbn5 APN 2 120054422 unclassified probably benign
IGL01800:Sptbn5 APN 2 120056427 unclassified probably benign
IGL02156:Sptbn5 APN 2 120047617 unclassified probably benign
R0020:Sptbn5 UTSW 2 120065631 missense probably damaging 0.96
R0690:Sptbn5 UTSW 2 120062675 unclassified probably null
R1121:Sptbn5 UTSW 2 120069390 unclassified probably null
R1223:Sptbn5 UTSW 2 120072044 missense probably damaging 0.99
R1405:Sptbn5 UTSW 2 120050616 splice site noncoding transcript
R1852:Sptbn5 UTSW 2 120071644 missense possibly damaging 0.52
R1927:Sptbn5 UTSW 2 120070462 missense probably benign 0.00
R2570:Sptbn5 UTSW 2 120048640 exon noncoding transcript
R3898:Sptbn5 UTSW 2 120057210 exon noncoding transcript
R3976:Sptbn5 UTSW 2 120048261 splice site noncoding transcript
R4092:Sptbn5 UTSW 2 120067051 missense probably damaging 0.99
R4119:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4120:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4351:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4352:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4364:Sptbn5 UTSW 2 120068655 missense probably damaging 1.00
R4371:Sptbn5 UTSW 2 120065994 missense probably damaging 1.00
R4606:Sptbn5 UTSW 2 120067446 unclassified probably null
R4616:Sptbn5 UTSW 2 120048757 exon noncoding transcript
R4687:Sptbn5 UTSW 2 120077208 unclassified probably benign
R4693:Sptbn5 UTSW 2 120059416 unclassified probably benign
R4762:Sptbn5 UTSW 2 120077222 unclassified noncoding transcript
R4798:Sptbn5 UTSW 2 120059141 unclassified probably benign
R4818:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4822:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4825:Sptbn5 UTSW 2 120055893 unclassified probably benign
R4933:Sptbn5 UTSW 2 120050120 exon noncoding transcript
R4970:Sptbn5 UTSW 2 120051777 exon noncoding transcript
R5209:Sptbn5 UTSW 2 120072002 missense probably benign 0.09
R5225:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5227:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5421:Sptbn5 UTSW 2 120080780 critical splice donor site noncoding transcript
R5495:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5498:Sptbn5 UTSW 2 120076638 unclassified probably benign
R5511:Sptbn5 UTSW 2 120059721 unclassified probably benign
R5596:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5616:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5617:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5619:Sptbn5 UTSW 2 120050132 exon noncoding transcript
R5625:Sptbn5 UTSW 2 120079792 exon noncoding transcript
R5636:Sptbn5 UTSW 2 120057404 unclassified probably benign
R5646:Sptbn5 UTSW 2 120048811 splice site noncoding transcript
R5666:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5670:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5715:Sptbn5 UTSW 2 120072504 missense probably damaging 1.00
R5774:Sptbn5 UTSW 2 120050458 exon noncoding transcript
R5885:Sptbn5 UTSW 2 120076663 unclassified probably benign
R6016:Sptbn5 UTSW 2 120050092 exon noncoding transcript
R6183:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6184:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6219:Sptbn5 UTSW 2 120077322 unclassified probably benign
R6335:Sptbn5 UTSW 2 120054419 unclassified probably benign
R6383:Sptbn5 UTSW 2 120046269 unclassified probably benign
R6450:Sptbn5 UTSW 2 120047135 unclassified probably benign
R6516:Sptbn5 UTSW 2 120047950 unclassified probably benign
R6523:Sptbn5 UTSW 2 120065614 unclassified probably null
R6657:Sptbn5 UTSW 2 120076400 unclassified probably benign
R6661:Sptbn5 UTSW 2 120072375 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCTTTGAGGAGAGACTGATGG -3'
(R):5'- ACAAGCCCTGAGTCAGACAG -3'

Sequencing Primer
(F):5'- GCAGCCTAAGGGAGGGC -3'
(R):5'- CCTGAGTCAGACAGCTTGATG -3'
Posted On2016-06-21