Incidental Mutation 'R5186:Kat7'
ID 397900
Institutional Source Beutler Lab
Gene Symbol Kat7
Ensembl Gene ENSMUSG00000038909
Gene Name K(lysine) acetyltransferase 7
Synonyms Myst2, Hboa, Hbo1
MMRRC Submission 042765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5186 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 95274259-95310246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95286416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 293 (T293S)
Ref Sequence ENSEMBL: ENSMUSP00000103362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072621] [ENSMUST00000092766] [ENSMUST00000103159] [ENSMUST00000107733] [ENSMUST00000107734]
AlphaFold Q5SVQ0
Predicted Effect probably benign
Transcript: ENSMUST00000072621
AA Change: T265S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072416
Gene: ENSMUSG00000038909
AA Change: T265S

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 184 214 3.2e-17 PFAM
ZnF_C2H2 338 364 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092766
AA Change: T295S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090441
Gene: ENSMUSG00000038909
AA Change: T295S

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 186 214 1.2e-16 PFAM
ZnF_C2H2 368 394 1.86e1 SMART
Pfam:MOZ_SAS 395 573 7.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103159
AA Change: T204S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099448
Gene: ENSMUSG00000038909
AA Change: T204S

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
Pfam:zf-C2HC 123 153 2.8e-17 PFAM
ZnF_C2H2 277 303 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107733
AA Change: T263S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103361
Gene: ENSMUSG00000038909
AA Change: T263S

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.3e-17 PFAM
ZnF_C2H2 336 362 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107734
AA Change: T293S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103362
Gene: ENSMUSG00000038909
AA Change: T293S

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.5e-17 PFAM
ZnF_C2H2 366 392 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138671
SMART Domains Protein: ENSMUSP00000121772
Gene: ENSMUSG00000038909

DomainStartEndE-ValueType
Pfam:MOZ_SAS 1 148 1.7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149356
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the multimeric HBO1 complex, which possesses histone H4-specific acetyltransferase activity. This activity is required for functional replication origins and is involved in transcriptional activation of some genes. In both cases, the acetylation of histone H4 helps unfold chromatin so that the DNA can be accessed and replicated or transcribed. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic growth arrest, incomplete embryo turning, disorganized yolk sac vascular plexus, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,743,739 L89H probably damaging Het
Abca8a T C 11: 110,091,599 I6V probably null Het
Aox1 A G 1: 58,068,370 D601G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cacna1g T G 11: 94,442,848 N931T probably damaging Het
Ccdc14 T C 16: 34,721,585 F511L probably damaging Het
Cd177 T A 7: 24,744,923 E710V probably benign Het
Cep112 T C 11: 108,752,560 C49R probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Dnah2 T C 11: 69,435,884 N3575S probably damaging Het
Dnah6 T A 6: 73,067,427 I3234F probably damaging Het
Eci3 G T 13: 34,946,978 A302E possibly damaging Het
Fam204a T C 19: 60,199,989 K214E probably damaging Het
Fam78a T C 2: 32,082,654 T85A possibly damaging Het
Flnb T C 14: 7,909,748 Y1401H probably damaging Het
Foxl2 A T 9: 98,956,055 D132V probably damaging Het
Frs2 C A 10: 117,078,842 W57C probably damaging Het
Gm26558 G T 2: 70,661,417 probably benign Het
Gpr139 A G 7: 119,144,840 V174A probably benign Het
Grik5 T C 7: 25,015,819 T676A probably damaging Het
H60c T C 10: 3,259,273 probably null Het
Hspa1l A G 17: 34,978,469 K495E probably damaging Het
Irgm1 C T 11: 48,866,217 V256I probably benign Het
Lipg C T 18: 74,960,938 V13I probably benign Het
Lrrn1 A T 6: 107,569,224 Y661F probably damaging Het
Mllt3 A G 4: 87,840,995 V272A probably benign Het
Mx1 G A 16: 97,455,494 R162C probably benign Het
Myo18b T A 5: 112,871,470 D647V probably damaging Het
Naf1 G A 8: 66,879,646 V329I probably benign Het
Olfr1286 A T 2: 111,420,774 M59K probably damaging Het
Olfr654 A T 7: 104,588,211 I153F probably damaging Het
Olfr936 A T 9: 39,046,969 C194* probably null Het
P2rx5 G A 11: 73,171,790 V442M possibly damaging Het
Pcdhb9 A G 18: 37,401,232 E93G probably damaging Het
Pcdhga4 A T 18: 37,687,426 N676I probably benign Het
Pgm5 A G 19: 24,820,128 M230T probably damaging Het
Pik3c2g T C 6: 139,622,018 V44A probably damaging Het
Pp2d1 T C 17: 53,508,140 M519V probably benign Het
Ppp1r10 A G 17: 35,928,511 E404G probably damaging Het
Prpf8 A T 11: 75,489,783 E104V possibly damaging Het
Ptpa T C 2: 30,438,355 probably null Het
Pygl A C 12: 70,201,344 N248K probably damaging Het
Rbm8a A G 3: 96,630,932 D102G probably damaging Het
Sema3d A G 5: 12,584,908 D647G probably benign Het
Serpinb11 A T 1: 107,379,754 D305V probably damaging Het
Slc12a8 T C 16: 33,617,208 I337T probably damaging Het
Slc29a2 G A 19: 5,028,967 R286Q probably benign Het
Slc2a3 T A 6: 122,735,583 D234V probably damaging Het
Slco4a1 T C 2: 180,473,108 V608A probably damaging Het
Srrm2 C T 17: 23,816,587 T831I probably benign Het
St18 T A 1: 6,802,317 probably null Het
Tesk2 G C 4: 116,741,896 G67A probably damaging Het
Tlr1 A T 5: 64,925,221 L671H probably damaging Het
Tmem63b A T 17: 45,661,477 Y735N possibly damaging Het
Tmprss11a C T 5: 86,420,079 C263Y probably damaging Het
Trio A T 15: 27,897,991 V345E probably damaging Het
Ubr5 A G 15: 37,997,916 S1674P probably damaging Het
Uchl3 T A 14: 101,695,917 C209S probably damaging Het
Uhmk1 T C 1: 170,211,167 N206S probably damaging Het
Uhrf1 C T 17: 56,318,340 R588W probably damaging Het
Usp28 T C 9: 49,010,250 V256A probably damaging Het
Utrn C A 10: 12,728,777 L552F probably damaging Het
Vmn1r55 A T 7: 5,146,986 M146K probably damaging Het
Vmn1r57 A C 7: 5,221,108 I211L probably benign Het
Zar1 C T 5: 72,577,399 C316Y probably damaging Het
Zc3h11a A T 1: 133,621,674 S750T probably damaging Het
Zcchc6 A G 13: 59,816,656 probably null Het
Zfp366 G A 13: 99,246,168 C613Y probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp516 T C 18: 82,957,093 V472A probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Kat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Kat7 APN 11 95306133 missense probably benign 0.01
IGL03287:Kat7 APN 11 95300109 missense probably damaging 1.00
R0047:Kat7 UTSW 11 95300208 missense probably benign 0.07
R0578:Kat7 UTSW 11 95291524 missense probably benign 0.00
R1739:Kat7 UTSW 11 95276547 missense possibly damaging 0.85
R2038:Kat7 UTSW 11 95300102 missense probably benign 0.14
R2115:Kat7 UTSW 11 95303294 missense probably benign 0.10
R2214:Kat7 UTSW 11 95275805 missense probably damaging 0.99
R2355:Kat7 UTSW 11 95291581 missense probably benign
R3425:Kat7 UTSW 11 95303165 missense probably damaging 1.00
R3775:Kat7 UTSW 11 95291531 missense probably benign 0.00
R3811:Kat7 UTSW 11 95291615 splice site probably benign
R4066:Kat7 UTSW 11 95284141 missense possibly damaging 0.93
R4169:Kat7 UTSW 11 95280472 missense probably damaging 0.99
R4657:Kat7 UTSW 11 95277598 missense probably damaging 1.00
R4814:Kat7 UTSW 11 95303123 splice site probably benign
R6015:Kat7 UTSW 11 95284034 missense probably damaging 1.00
R6820:Kat7 UTSW 11 95284139 missense probably damaging 1.00
R6894:Kat7 UTSW 11 95284084 missense possibly damaging 0.86
R7192:Kat7 UTSW 11 95275830 missense probably benign 0.00
R7217:Kat7 UTSW 11 95291564 missense possibly damaging 0.79
R7728:Kat7 UTSW 11 95300081 missense probably benign 0.25
R7999:Kat7 UTSW 11 95284109 missense probably damaging 1.00
R8230:Kat7 UTSW 11 95277589 missense probably damaging 1.00
R8747:Kat7 UTSW 11 95294566 missense probably damaging 1.00
R8929:Kat7 UTSW 11 95306156 missense probably damaging 1.00
R9166:Kat7 UTSW 11 95300102 missense probably benign
R9239:Kat7 UTSW 11 95306194 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGTGTGCTCTCCGTGTAAAAG -3'
(R):5'- GGGTTACCAGTTTGCCTGAG -3'

Sequencing Primer
(F):5'- CCAGAGATGTCATCAGACTGGTTG -3'
(R):5'- ACCAGTTTGCCTGAGCTCAG -3'
Posted On 2016-07-06