Incidental Mutation 'R5259:Gm5415'
ID401274
Institutional Source Beutler Lab
Gene Symbol Gm5415
Ensembl Gene ENSMUSG00000091318
Gene Namepredicted gene 5415
Synonyms
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5259 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location32543686-32547294 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 32545517 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 437 (C437*)
Ref Sequence ENSEMBL: ENSMUSP00000132789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000171322]
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171322
AA Change: C437*
SMART Domains Protein: ENSMUSP00000132789
Gene: ENSMUSG00000091318
AA Change: C437*

DomainStartEndE-ValueType
low complexity region 137 150 N/A INTRINSIC
Pfam:Peptidase_C48 298 477 7.4e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195761
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Gm5415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Gm5415 APN 1 32546667 missense probably benign
IGL01148:Gm5415 APN 1 32545654 missense possibly damaging 0.88
IGL02323:Gm5415 APN 1 32545704 nonsense probably null
IGL03076:Gm5415 APN 1 32545545 missense probably damaging 1.00
IGL03288:Gm5415 APN 1 32545760 missense probably benign 0.09
PIT4576001:Gm5415 UTSW 1 32546472 missense probably damaging 1.00
R0110:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0510:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0891:Gm5415 UTSW 1 32546361 missense possibly damaging 0.54
R1836:Gm5415 UTSW 1 32545677 missense probably damaging 1.00
R1939:Gm5415 UTSW 1 32545546 missense probably damaging 0.99
R2156:Gm5415 UTSW 1 32546047 missense probably benign 0.08
R2226:Gm5415 UTSW 1 32545853 missense probably damaging 1.00
R2422:Gm5415 UTSW 1 32545861 missense possibly damaging 0.73
R4761:Gm5415 UTSW 1 32546507 missense possibly damaging 0.51
R4901:Gm5415 UTSW 1 32546620 missense probably benign 0.00
R5129:Gm5415 UTSW 1 32545479 missense probably damaging 1.00
R5129:Gm5415 UTSW 1 32545480 missense probably damaging 1.00
R5184:Gm5415 UTSW 1 32545648 missense probably damaging 0.99
R6271:Gm5415 UTSW 1 32545491 missense probably damaging 1.00
R6589:Gm5415 UTSW 1 32546711 missense probably benign 0.44
R6746:Gm5415 UTSW 1 32546763 missense probably benign
R7720:Gm5415 UTSW 1 32546097 missense probably benign 0.00
R7855:Gm5415 UTSW 1 32546033 missense probably damaging 0.96
R7938:Gm5415 UTSW 1 32546033 missense probably damaging 0.96
R8006:Gm5415 UTSW 1 32546924 start gained probably benign
X0024:Gm5415 UTSW 1 32545711 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TTCAACGCACCCTACCTGAG -3'
(R):5'- ATTGGAGCCTGGTGGTAATC -3'

Sequencing Primer
(F):5'- GCACCCTACCTGAGGTATATAAG -3'
(R):5'- CCTGGTGGTAATCGATTTAAGGAAAC -3'
Posted On2016-07-06