Incidental Mutation 'R5265:Kdm2b'
ID 401644
Institutional Source Beutler Lab
Gene Symbol Kdm2b
Ensembl Gene ENSMUSG00000029475
Gene Name lysine (K)-specific demethylase 2B
Synonyms Cxxc2, Fbxl10, Jhdm1b
MMRRC Submission 042833-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5265 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 123008727-123127333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123016651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1161 (T1161A)
Ref Sequence ENSEMBL: ENSMUSP00000114052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031435] [ENSMUST00000046073] [ENSMUST00000086200] [ENSMUST00000118027] [ENSMUST00000121739] [ENSMUST00000127403] [ENSMUST00000152872]
AlphaFold Q6P1G2
Predicted Effect probably damaging
Transcript: ENSMUST00000031435
AA Change: T666A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031435
Gene: ENSMUSG00000029475
AA Change: T666A

DomainStartEndE-ValueType
Pfam:zf-CXXC 45 91 1.6e-17 PFAM
PHD 101 163 8.58e-4 SMART
low complexity region 259 290 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
FBOX 505 545 1.69e-2 SMART
LRR 588 610 1.31e2 SMART
LRR 612 637 2.9e2 SMART
LRR 652 676 2.04e2 SMART
LRR 677 702 1.1e1 SMART
LRR 732 757 3.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046073
AA Change: T1199A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038229
Gene: ENSMUSG00000029475
AA Change: T1199A

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 1e-17 PDB
Pfam:zf-CXXC 578 624 3e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 792 823 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 990 1006 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
FBOX 1038 1078 1.69e-2 SMART
LRR 1121 1143 1.31e2 SMART
LRR 1145 1170 2.9e2 SMART
LRR 1185 1209 2.04e2 SMART
LRR 1210 1235 1.1e1 SMART
LRR 1265 1290 3.91e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086200
AA Change: T1193A

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083376
Gene: ENSMUSG00000029475
AA Change: T1193A

DomainStartEndE-ValueType
Blast:JmjC 17 95 4e-41 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 540 1e-17 PDB
Pfam:zf-CXXC 572 618 2.1e-17 PFAM
PHD 628 690 8.58e-4 SMART
low complexity region 786 817 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 984 1000 N/A INTRINSIC
low complexity region 1012 1026 N/A INTRINSIC
FBOX 1032 1072 1.69e-2 SMART
LRR 1115 1137 1.31e2 SMART
LRR 1139 1164 2.9e2 SMART
LRR 1179 1203 2.04e2 SMART
LRR 1204 1229 1.1e1 SMART
LRR 1259 1284 3.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118027
AA Change: T1161A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114052
Gene: ENSMUSG00000029475
AA Change: T1161A

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 9e-18 PDB
Pfam:zf-CXXC 578 624 2.1e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 865 875 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
FBOX 1000 1040 1.69e-2 SMART
LRR 1083 1105 1.31e2 SMART
LRR 1107 1132 2.9e2 SMART
LRR 1147 1171 2.04e2 SMART
LRR 1172 1197 1.1e1 SMART
LRR 1227 1252 3.91e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121739
AA Change: T1144A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114049
Gene: ENSMUSG00000029475
AA Change: T1144A

DomainStartEndE-ValueType
Blast:JmjC 1 46 2e-19 BLAST
JmjC 92 260 3.61e-41 SMART
low complexity region 325 346 N/A INTRINSIC
low complexity region 351 369 N/A INTRINSIC
PDB:2YU2|A 417 491 1e-17 PDB
Pfam:zf-CXXC 523 569 5.4e-17 PFAM
PHD 579 641 8.58e-4 SMART
low complexity region 737 768 N/A INTRINSIC
low complexity region 848 858 N/A INTRINSIC
low complexity region 935 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
FBOX 983 1023 1.69e-2 SMART
LRR 1066 1088 1.31e2 SMART
LRR 1090 1115 2.9e2 SMART
LRR 1130 1154 2.04e2 SMART
LRR 1155 1180 1.1e1 SMART
LRR 1210 1235 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174357
Predicted Effect probably benign
Transcript: ENSMUST00000152872
SMART Domains Protein: ENSMUSP00000119746
Gene: ENSMUSG00000029475

DomainStartEndE-ValueType
PHD 25 87 8.58e-4 SMART
low complexity region 243 253 N/A INTRINSIC
Meta Mutation Damage Score 0.8454 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: The protein encoded by this gene is a H3K36-specific histone demethylase, which contains an N-terminal jumonji C domain, a CxxC zinc finger domain, a plant homeodomain finger, an F-box, and eight leucine-rich repeats. Amongst its demonstrated functions, this protein plays roles in the suppression of premature cellular senescence, leukemia maintenance and development, maintenance of mouse embryonic stem cell pluripotency, and induced pluripotent stem cell generation. Mice homozygous for a targeted deletion of the zinc finger domain display embryonic lethality with development ceasing at approximately 7 to 8 days post coitum, demonstrating an essential role in early development. A pseudogene of this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted allele that does not express the long form protein exhibit exencephaly, fetal and postnatal lethality, coloboma, curly tail, oligozoospermia, increased apoptosis, and increased neuronal precursor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,166,177 (GRCm39) W66R probably damaging Het
Adamts3 A G 5: 90,009,411 (GRCm39) V84A possibly damaging Het
Caap1 C A 4: 94,389,465 (GRCm39) E290* probably null Het
Cant1 G A 11: 118,298,876 (GRCm39) R296C probably damaging Het
Cdh5 A T 8: 104,869,371 (GRCm39) H699L probably benign Het
Cfdp1 T C 8: 112,557,617 (GRCm39) T175A probably benign Het
Col4a4 C T 1: 82,471,312 (GRCm39) G681E unknown Het
Comtd1 G A 14: 21,898,861 (GRCm39) T27I probably benign Het
Copg1 T A 6: 87,869,252 (GRCm39) V155D probably damaging Het
Dag1 A G 9: 108,084,898 (GRCm39) Y748H possibly damaging Het
Dmwd T A 7: 18,814,206 (GRCm39) N285K possibly damaging Het
Dsp A G 13: 38,379,159 (GRCm39) E1968G possibly damaging Het
Ednra A G 8: 78,394,004 (GRCm39) I364T probably damaging Het
Elovl3 C A 19: 46,123,120 (GRCm39) T232K probably damaging Het
Ercc3 T A 18: 32,387,296 (GRCm39) I503N probably damaging Het
Ercc6 C A 14: 32,291,580 (GRCm39) A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,698,953 (GRCm39) probably null Het
H2-DMb2 G T 17: 34,367,536 (GRCm39) V117F probably damaging Het
Helt A T 8: 46,745,470 (GRCm39) W138R probably damaging Het
Itga11 A T 9: 62,644,694 (GRCm39) H215L probably benign Het
Kcnn1 T A 8: 71,307,297 (GRCm39) I156F probably benign Het
Kdm1b A G 13: 47,216,445 (GRCm39) N272D probably benign Het
Lin54 A G 5: 100,633,378 (GRCm39) L102P probably damaging Het
Mlh1 A C 9: 111,100,591 (GRCm39) M1R probably null Het
Naip2 G A 13: 100,289,068 (GRCm39) L1165F probably damaging Het
Nfkbiz A G 16: 55,640,004 (GRCm39) S118P probably damaging Het
Nkx3-2 T A 5: 41,919,191 (GRCm39) M266L probably benign Het
Npr1 T C 3: 90,364,309 (GRCm39) E771G probably benign Het
Obox8 C T 7: 14,065,954 (GRCm39) R188H probably benign Het
Odad1 T A 7: 45,596,859 (GRCm39) D395E probably damaging Het
Or5h19 A T 16: 58,856,506 (GRCm39) V198D possibly damaging Het
Or5p72 T A 7: 108,022,609 (GRCm39) V277E possibly damaging Het
Palm3 T C 8: 84,748,159 (GRCm39) probably null Het
Palmd A T 3: 116,717,498 (GRCm39) V333D possibly damaging Het
Pikfyve A G 1: 65,306,988 (GRCm39) E1747G possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Ranbp3l T A 15: 9,037,077 (GRCm39) F127I probably benign Het
Rsl1d1 A G 16: 11,019,248 (GRCm39) F97L possibly damaging Het
Scaper A G 9: 55,771,830 (GRCm39) V362A probably benign Het
Scg5 A T 2: 113,607,210 (GRCm39) L192* probably null Het
Slc34a2 T C 5: 53,218,776 (GRCm39) I198T probably damaging Het
Slc45a3 T A 1: 131,905,932 (GRCm39) D318E possibly damaging Het
Sorl1 A G 9: 42,017,812 (GRCm39) M105T possibly damaging Het
St3gal5 T A 6: 72,126,115 (GRCm39) I320N probably damaging Het
Stx17 A G 4: 48,183,470 (GRCm39) probably benign Het
Syt5 C T 7: 4,544,074 (GRCm39) probably null Het
Thrap3 A G 4: 126,061,433 (GRCm39) S774P probably damaging Het
Tnc A T 4: 63,911,443 (GRCm39) M1376K probably benign Het
Tnks1bp1 T A 2: 84,893,098 (GRCm39) D1008E probably benign Het
Trav7-1 G T 14: 52,892,761 (GRCm39) A105S probably damaging Het
Vmn1r28 T A 6: 58,242,949 (GRCm39) V264D probably damaging Het
Vmn1r44 T C 6: 89,870,821 (GRCm39) V46A probably benign Het
Vmn2r10 A G 5: 109,143,586 (GRCm39) I788T probably damaging Het
Vmn2r78 T A 7: 86,569,332 (GRCm39) I75N probably damaging Het
Zfp821 T C 8: 110,450,991 (GRCm39) M328T probably damaging Het
Zfp995 G A 17: 22,099,604 (GRCm39) P210L possibly damaging Het
Other mutations in Kdm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Kdm2b APN 5 123,099,630 (GRCm39) missense probably damaging 1.00
IGL02061:Kdm2b APN 5 123,021,404 (GRCm39) missense probably damaging 1.00
IGL02142:Kdm2b APN 5 123,085,898 (GRCm39) missense probably damaging 0.99
IGL02143:Kdm2b APN 5 123,085,898 (GRCm39) missense probably damaging 0.99
IGL02147:Kdm2b APN 5 123,085,898 (GRCm39) missense probably damaging 0.99
IGL02294:Kdm2b APN 5 123,099,537 (GRCm39) missense probably damaging 1.00
IGL02309:Kdm2b APN 5 123,085,883 (GRCm39) missense probably damaging 0.99
IGL03039:Kdm2b APN 5 123,019,734 (GRCm39) missense probably benign 0.06
IGL03134:Kdm2b UTSW 5 123,070,737 (GRCm39) missense probably damaging 1.00
PIT4520001:Kdm2b UTSW 5 123,079,110 (GRCm39) missense probably damaging 1.00
R0008:Kdm2b UTSW 5 123,019,806 (GRCm39) missense probably benign 0.08
R0592:Kdm2b UTSW 5 123,099,197 (GRCm39) splice site probably benign
R0894:Kdm2b UTSW 5 123,122,523 (GRCm39) critical splice donor site probably null
R1078:Kdm2b UTSW 5 123,099,604 (GRCm39) missense possibly damaging 0.83
R1387:Kdm2b UTSW 5 123,018,331 (GRCm39) missense probably damaging 1.00
R1441:Kdm2b UTSW 5 123,070,943 (GRCm39) missense probably benign 0.25
R1550:Kdm2b UTSW 5 123,019,120 (GRCm39) missense probably damaging 1.00
R1795:Kdm2b UTSW 5 123,122,523 (GRCm39) critical splice donor site probably null
R2060:Kdm2b UTSW 5 123,021,428 (GRCm39) missense probably damaging 1.00
R2161:Kdm2b UTSW 5 123,018,762 (GRCm39) missense probably damaging 1.00
R2259:Kdm2b UTSW 5 123,020,479 (GRCm39) missense probably damaging 1.00
R3843:Kdm2b UTSW 5 123,072,856 (GRCm39) missense probably damaging 0.98
R3844:Kdm2b UTSW 5 123,072,856 (GRCm39) missense probably damaging 0.98
R3859:Kdm2b UTSW 5 123,018,290 (GRCm39) missense probably damaging 1.00
R4506:Kdm2b UTSW 5 123,026,688 (GRCm39) missense possibly damaging 0.58
R4680:Kdm2b UTSW 5 123,072,849 (GRCm39) missense probably damaging 0.99
R4786:Kdm2b UTSW 5 123,018,917 (GRCm39) critical splice acceptor site probably null
R4894:Kdm2b UTSW 5 123,079,030 (GRCm39) nonsense probably null
R5522:Kdm2b UTSW 5 123,087,225 (GRCm39) missense probably damaging 1.00
R5746:Kdm2b UTSW 5 123,017,427 (GRCm39) missense probably damaging 1.00
R5813:Kdm2b UTSW 5 123,009,931 (GRCm39) missense probably benign 0.37
R5920:Kdm2b UTSW 5 123,018,359 (GRCm39) missense probably damaging 1.00
R5961:Kdm2b UTSW 5 123,070,724 (GRCm39) missense probably benign 0.37
R6029:Kdm2b UTSW 5 123,017,650 (GRCm39) missense probably damaging 1.00
R6280:Kdm2b UTSW 5 123,016,687 (GRCm39) missense probably damaging 1.00
R6303:Kdm2b UTSW 5 123,019,807 (GRCm39) missense probably benign 0.34
R6304:Kdm2b UTSW 5 123,019,807 (GRCm39) missense probably benign 0.34
R6383:Kdm2b UTSW 5 123,072,841 (GRCm39) missense probably damaging 1.00
R6432:Kdm2b UTSW 5 123,018,254 (GRCm39) missense probably damaging 1.00
R6513:Kdm2b UTSW 5 123,018,302 (GRCm39) missense probably damaging 0.99
R6526:Kdm2b UTSW 5 123,099,532 (GRCm39) missense probably damaging 1.00
R7213:Kdm2b UTSW 5 123,059,532 (GRCm39) missense probably damaging 0.99
R7226:Kdm2b UTSW 5 123,059,512 (GRCm39) missense possibly damaging 0.60
R7292:Kdm2b UTSW 5 123,018,854 (GRCm39) missense probably damaging 0.98
R7893:Kdm2b UTSW 5 123,085,802 (GRCm39) missense probably benign 0.12
R8021:Kdm2b UTSW 5 123,070,982 (GRCm39) missense probably damaging 0.99
R8038:Kdm2b UTSW 5 123,098,958 (GRCm39) intron probably benign
R8162:Kdm2b UTSW 5 123,072,856 (GRCm39) missense probably damaging 0.98
R8397:Kdm2b UTSW 5 123,018,579 (GRCm39) missense probably benign 0.03
R8411:Kdm2b UTSW 5 123,018,239 (GRCm39) missense probably damaging 1.00
R8899:Kdm2b UTSW 5 123,125,851 (GRCm39) nonsense probably null
R8997:Kdm2b UTSW 5 123,018,236 (GRCm39) missense probably null 0.99
R9142:Kdm2b UTSW 5 123,127,112 (GRCm39) unclassified probably benign
R9192:Kdm2b UTSW 5 123,070,679 (GRCm39) missense probably benign 0.05
R9238:Kdm2b UTSW 5 123,009,889 (GRCm39) missense probably damaging 0.98
R9455:Kdm2b UTSW 5 123,099,537 (GRCm39) missense probably damaging 1.00
R9644:Kdm2b UTSW 5 123,120,842 (GRCm39) missense probably damaging 0.98
R9731:Kdm2b UTSW 5 123,125,823 (GRCm39) missense probably benign 0.03
Z1177:Kdm2b UTSW 5 123,018,860 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACCGCTGTAACCAGATACTG -3'
(R):5'- CTGATGTGGAAGCTTCTAAGGATG -3'

Sequencing Primer
(F):5'- AGATACTGGGGCCCACCTC -3'
(R):5'- AAGCTTCTAAGGATGAGATTCTGGC -3'
Posted On 2016-07-06