Incidental Mutation 'R5302:Slc44a3'
List |< first << previous [record 36 of 42] next >> last >|
ID404288
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Namesolute carrier family 44, member 3
Synonyms
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121459528-121532404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121510313 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
Predicted Effect probably damaging
Transcript: ENSMUST00000039197
AA Change: V258A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: V258A

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8104:Slc44a3 UTSW 3 121497872 missense probably benign 0.01
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCTCAGCTCTCTCGGGAAATAG -3'
(R):5'- CTTGGCACAGATCACCTAGAG -3'

Sequencing Primer
(F):5'- GAAATAGTCCTCCCTAGGGTTGC -3'
(R):5'- CCAAGCTTTTGAGGCTATAGGATCC -3'
Posted On2016-07-22