Mutagenetix > Incidental Mutations

Incidental Mutation 'R5440:Pkp1'

428566

Institutional Source

Beutler Lab

Gene Symbol

Pkp1

Ensembl Gene

ENSMUSG00000026413

Gene Name

plakophilin 1

Synonyms

MMRRC Submission

043005-MU

Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene?

Possibly essential (E-score: 0.522) question?

Stock #

R5440 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135871395-135919207 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135882492 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 447 (C447S)

Ref Sequence

ENSEMBL: ENSMUSP00000128418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]

Predicted Effect

probably benign
Transcript: ENSMUST00000027667
AA Change: C447S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: C447S

Domain	Start	End	E-Value	Type
low complexity region	52	60	N/A	INTRINSIC
ARM	277	317	2.65e-9	SMART
ARM	319	360	3.47e-4	SMART
ARM	361	416	1.3e1	SMART
ARM	417	464	5.59e1	SMART
ARM	516	557	8.48e1	SMART
ARM	565	604	3.85e0	SMART
ARM	605	650	5.76e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132793

Predicted Effect

probably benign
Transcript: ENSMUST00000163260
AA Change: C447S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: C447S

Domain	Start	End	E-Value	Type
low complexity region	52	60	N/A	INTRINSIC
ARM	277	317	2.65e-9	SMART
ARM	319	360	3.47e-4	SMART
ARM	361	416	1.3e1	SMART
ARM	417	464	5.59e1	SMART
ARM	516	557	8.48e1	SMART
ARM	565	604	3.85e0	SMART
ARM	605	650	5.76e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189805

SMART Domains

Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

Domain	Start	End	E-Value	Type
low complexity region	52	60	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	G	T	18: 34,221,160		probably benign	Het
Apol11b	T	A	15: 77,635,593	K96*	probably null	Het
Arhgap35	C	T	7: 16,562,924	G739S	probably damaging	Het
Atp6v0a4	A	C	6: 38,092,817	F47V	probably damaging	Het
Bcl9	G	A	3: 97,210,565	P271L	probably benign	Het
Cd109	T	C	9: 78,680,164		probably null	Het
Col12a1	T	A	9: 79,614,363	I2771F	probably benign	Het
Col6a1	A	G	10: 76,723,454	V116A	probably damaging	Het
Cpsf2	C	G	12: 101,996,879	L401V	probably benign	Het
Cwf19l2	G	A	9: 3,475,549	E829K	probably damaging	Het
D7Ertd443e	G	A	7: 134,349,275	T223I	probably damaging	Het
Dtx4	G	A	19: 12,492,317	R149C	probably damaging	Het
Fam186b	C	T	15: 99,273,853	A838T	possibly damaging	Het
Fzd4	G	T	7: 89,408,118	E458*	probably null	Het
Gm17669	C	T	18: 67,562,456	P24S	possibly damaging	Het
Grin2b	C	T	6: 135,736,306	G859D	probably damaging	Het
Gucy2e	T	C	11: 69,223,646	Y1019C	probably damaging	Het
Gzme	T	A	14: 56,118,453	N134I	possibly damaging	Het
Havcr1	A	T	11: 46,752,370	Y39F	probably damaging	Het
Hint3	A	T	10: 30,618,351	M1K	probably null	Het
Hspa4l	A	G	3: 40,781,576	K543R	probably damaging	Het
Ifna9	A	G	4: 88,591,811		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Lipo2	A	G	19: 33,720,858	I373T	probably benign	Het
Myo5c	T	A	9: 75,258,125	I405N	possibly damaging	Het
Olfr517	T	C	7: 108,868,626	H176R	probably damaging	Het
P2rx1	A	G	11: 73,008,503	M108V	probably benign	Het
Pcsk2	T	A	2: 143,546,543	V18E	probably benign	Het
Pigr	A	T	1: 130,849,622		probably null	Het
Prom1	T	A	5: 44,058,646	I96F	probably benign	Het
Prpf4b	T	C	13: 34,884,093		probably benign	Het
Ropn1	C	A	16: 34,671,172	D102E	probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Sphk1	T	G	11: 116,534,888	V17G	possibly damaging	Het
Syngr1	A	G	15: 80,098,018	N2S	probably benign	Het
Syt9	T	G	7: 107,502,123	S359A	possibly damaging	Het
Terb1	T	C	8: 104,488,499	I282V	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Ttn	A	T	2: 76,909,256	D3646E	probably benign	Het
Ube2d1	A	G	10: 71,255,852	W141R	probably damaging	Het
Vmn2r41	T	A	7: 8,138,363	I701F	probably damaging	Het
Zfp770	T	C	2: 114,196,115	D491G	probably benign	Het

Other mutations in Pkp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Pkp1	APN	1	135878184	missense	probably damaging	0.96
IGL02113:Pkp1	APN	1	135883914	missense	possibly damaging	0.92
IGL02149:Pkp1	APN	1	135886747	missense	probably benign	0.00
IGL02582:Pkp1	APN	1	135889926	missense	probably damaging	0.99
IGL02655:Pkp1	APN	1	135889773	missense	probably benign	0.14
IGL03166:Pkp1	APN	1	135878124	missense	probably damaging	1.00
P0008:Pkp1	UTSW	1	135875683	missense	probably benign	0.00
R0180:Pkp1	UTSW	1	135886800	missense	probably benign	0.00
R0368:Pkp1	UTSW	1	135875683	missense	probably benign
R0368:Pkp1	UTSW	1	135886852	missense	probably benign	0.00
R0601:Pkp1	UTSW	1	135878182	missense	probably damaging	1.00
R0725:Pkp1	UTSW	1	135880740	missense	probably benign	0.02
R1414:Pkp1	UTSW	1	135884085	splice site	probably benign
R1926:Pkp1	UTSW	1	135877673	missense	probably benign
R2082:Pkp1	UTSW	1	135884976	missense	possibly damaging	0.48
R2190:Pkp1	UTSW	1	135879971	missense	probably benign	0.02
R2249:Pkp1	UTSW	1	135880807	missense	probably damaging	1.00
R4457:Pkp1	UTSW	1	135875624	makesense	probably null
R4838:Pkp1	UTSW	1	135882588	missense	probably damaging	1.00
R4885:Pkp1	UTSW	1	135918952	missense	possibly damaging	0.92
R4995:Pkp1	UTSW	1	135880855	missense	possibly damaging	0.91
R5436:Pkp1	UTSW	1	135918918	missense	probably damaging	1.00
R5652:Pkp1	UTSW	1	135882597	critical splice acceptor site	probably null
R5898:Pkp1	UTSW	1	135882521	missense	probably damaging	1.00
R5908:Pkp1	UTSW	1	135918883	nonsense	probably null
R6006:Pkp1	UTSW	1	135877668	splice site	probably null
R6013:Pkp1	UTSW	1	135883910	missense	probably damaging	1.00
R6218:Pkp1	UTSW	1	135879908	missense	probably damaging	0.96
R6232:Pkp1	UTSW	1	135886861	missense	probably benign	0.01
R7000:Pkp1	UTSW	1	135889954	missense	probably benign	0.41
R7799:Pkp1	UTSW	1	135889957	missense	possibly damaging	0.94
R7883:Pkp1	UTSW	1	135884903	critical splice donor site	probably null
R8486:Pkp1	UTSW	1	135918976	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTTGCATGTTTCAGATGTC -3'
(R):5'- TTCACTGTGCATGCCCACTG -3'

Sequencing Primer
(F):5'- GTCTCTGAGACAAAGTCCACAAG -3'
(R):5'- ACTGCACTCTGCCCGTC -3'

Posted On

2016-09-01