Incidental Mutation 'R0368:Pkp1'
ID30304
Institutional Source Beutler Lab
Gene Symbol Pkp1
Ensembl Gene ENSMUSG00000026413
Gene Nameplakophilin 1
Synonyms
MMRRC Submission 038574-MU
Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R0368 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135871395-135919207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135886852 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 244 (S244G)
Ref Sequence ENSEMBL: ENSMUSP00000128418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]
Predicted Effect probably benign
Transcript: ENSMUST00000027667
AA Change: S244G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: S244G

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163260
AA Change: S244G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: S244G

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect silent
Transcript: ENSMUST00000189805
SMART Domains Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Pkp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pkp1 APN 1 135878184 missense probably damaging 0.96
IGL02113:Pkp1 APN 1 135883914 missense possibly damaging 0.92
IGL02149:Pkp1 APN 1 135886747 missense probably benign 0.00
IGL02582:Pkp1 APN 1 135889926 missense probably damaging 0.99
IGL02655:Pkp1 APN 1 135889773 missense probably benign 0.14
IGL03166:Pkp1 APN 1 135878124 missense probably damaging 1.00
P0008:Pkp1 UTSW 1 135875683 missense probably benign 0.00
R0180:Pkp1 UTSW 1 135886800 missense probably benign 0.00
R0368:Pkp1 UTSW 1 135875683 missense probably benign
R0601:Pkp1 UTSW 1 135878182 missense probably damaging 1.00
R0725:Pkp1 UTSW 1 135880740 missense probably benign 0.02
R1414:Pkp1 UTSW 1 135884085 splice site probably benign
R1926:Pkp1 UTSW 1 135877673 missense probably benign
R2082:Pkp1 UTSW 1 135884976 missense possibly damaging 0.48
R2190:Pkp1 UTSW 1 135879971 missense probably benign 0.02
R2249:Pkp1 UTSW 1 135880807 missense probably damaging 1.00
R4457:Pkp1 UTSW 1 135875624 makesense probably null
R4838:Pkp1 UTSW 1 135882588 missense probably damaging 1.00
R4885:Pkp1 UTSW 1 135918952 missense possibly damaging 0.92
R4995:Pkp1 UTSW 1 135880855 missense possibly damaging 0.91
R5436:Pkp1 UTSW 1 135918918 missense probably damaging 1.00
R5440:Pkp1 UTSW 1 135882492 missense probably benign 0.41
R5652:Pkp1 UTSW 1 135882597 critical splice acceptor site probably null
R5898:Pkp1 UTSW 1 135882521 missense probably damaging 1.00
R5908:Pkp1 UTSW 1 135918883 nonsense probably null
R6006:Pkp1 UTSW 1 135877668 splice site probably null
R6013:Pkp1 UTSW 1 135883910 missense probably damaging 1.00
R6218:Pkp1 UTSW 1 135879908 missense probably damaging 0.96
R6232:Pkp1 UTSW 1 135886861 missense probably benign 0.01
R7000:Pkp1 UTSW 1 135889954 missense probably benign 0.41
R7799:Pkp1 UTSW 1 135889957 missense possibly damaging 0.94
R7883:Pkp1 UTSW 1 135884903 critical splice donor site probably null
R7966:Pkp1 UTSW 1 135884903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGTGCTTCCACTCTTCTCCAAAG -3'
(R):5'- TAGCCCCTGAAAGGGATCGCATAC -3'

Sequencing Primer
(F):5'- TCTTCTCCAAAGGTGGGGC -3'
(R):5'- GGAGCTGTTCACAAGATTTTCTC -3'
Posted On2013-04-24