Incidental Mutation 'R5522:Plac8'
ID431606
Institutional Source Beutler Lab
Gene Symbol Plac8
Ensembl Gene ENSMUSG00000029322
Gene Nameplacenta-specific 8
SynonymsC15, D5Wsu111e, onzin
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5522 (G1)
Quality Score206
Status Not validated
Chromosome5
Chromosomal Location100553725-100572245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100562718 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 6 (T6S)
Ref Sequence ENSEMBL: ENSMUSP00000108531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031264] [ENSMUST00000097437] [ENSMUST00000112910]
Predicted Effect probably benign
Transcript: ENSMUST00000031264
AA Change: T6S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031264
Gene: ENSMUSG00000029322
AA Change: T6S

DomainStartEndE-ValueType
Pfam:PLAC8 23 102 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097437
AA Change: T6S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108533
Gene: ENSMUSG00000029322
AA Change: T6S

DomainStartEndE-ValueType
Pfam:PLAC8 23 103 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112910
AA Change: T6S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108531
Gene: ENSMUSG00000029322
AA Change: T6S

DomainStartEndE-ValueType
Pfam:PLAC8 23 103 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144595
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil capacity for intracellular bacteria killing and impaired brown adipose tissue and thermoregulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Plac8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0021:Plac8 UTSW 5 100556568 missense probably benign 0.03
R0021:Plac8 UTSW 5 100556568 missense probably benign 0.03
R1023:Plac8 UTSW 5 100556581 missense probably benign 0.07
R5213:Plac8 UTSW 5 100556505 missense probably benign
R5317:Plac8 UTSW 5 100556479 critical splice donor site probably null
R6735:Plac8 UTSW 5 100562619 splice site probably null
X0024:Plac8 UTSW 5 100559840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGTCTTTGACGTTTCCTG -3'
(R):5'- AGCTGATTTCTCCAACCACG -3'

Sequencing Primer
(F):5'- GTAACATTCCCAGATTCTCAGGAGTC -3'
(R):5'- ACGTCCTGTCCCTAGCCAG -3'
Posted On2016-10-05