Incidental Mutation 'R5522:Snrnp70'
ID431613
Institutional Source Beutler Lab
Gene Symbol Snrnp70
Ensembl Gene ENSMUSG00000063511
Gene Namesmall nuclear ribonucleoprotein 70 (U1)
SynonymsSrnp70, 2700022N21Rik, Rnulp70, Snrp70, U1-70, 3200002N22Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5522 (G1)
Quality Score192
Status Not validated
Chromosome7
Chromosomal Location45376453-45395742 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 45377177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074575] [ENSMUST00000210514] [ENSMUST00000211211]
Predicted Effect unknown
Transcript: ENSMUST00000074575
AA Change: R256H
SMART Domains Protein: ENSMUSP00000074160
Gene: ENSMUSG00000063511
AA Change: R256H

DomainStartEndE-ValueType
Pfam:U1snRNP70_N 2 94 4e-31 PFAM
RRM 104 177 1.62e-23 SMART
low complexity region 186 203 N/A INTRINSIC
coiled coil region 286 309 N/A INTRINSIC
low complexity region 331 409 N/A INTRINSIC
PDB:3PGW|L 410 448 4e-14 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209993
Predicted Effect probably benign
Transcript: ENSMUST00000210514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211178
Predicted Effect probably benign
Transcript: ENSMUST00000211211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211366
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the U1 snRNP (small nuclear ribonucleic particle), one of at least five snRNPs to comprise the spliceosome, which functions in processing of pre-mRNAs. The U1 snRNP has been shown to be important in defining the 5' splice site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Snrnp70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Snrnp70 APN 7 45377354 critical splice donor site probably null
IGL01092:Snrnp70 APN 7 45377377 missense probably damaging 0.98
IGL01444:Snrnp70 APN 7 45387236 unclassified probably null
IGL03110:Snrnp70 APN 7 45376859 intron probably benign
R0691:Snrnp70 UTSW 7 45387245 missense possibly damaging 0.60
R1371:Snrnp70 UTSW 7 45380705 unclassified probably benign
R1854:Snrnp70 UTSW 7 45377220 nonsense probably null
R1880:Snrnp70 UTSW 7 45377362 intron probably null
R2050:Snrnp70 UTSW 7 45387300 nonsense probably null
R4928:Snrnp70 UTSW 7 45377281 splice site probably null
R5195:Snrnp70 UTSW 7 45394710 missense probably damaging 1.00
R5314:Snrnp70 UTSW 7 45377052 nonsense probably null
R5326:Snrnp70 UTSW 7 45377233 intron probably benign
R6182:Snrnp70 UTSW 7 45377073 nonsense probably null
R6739:Snrnp70 UTSW 7 45387419 missense probably damaging 1.00
R7607:Snrnp70 UTSW 7 45392264 missense possibly damaging 0.82
R7789:Snrnp70 UTSW 7 45376621 nonsense probably null
R7840:Snrnp70 UTSW 7 45376790 missense unknown
R7923:Snrnp70 UTSW 7 45376790 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGAGGGTTCAGCCATGTC -3'
(R):5'- CACTTCCCGATATGATGAGAGG -3'

Sequencing Primer
(F):5'- TTCAGCCATGTCGCCGC -3'
(R):5'- TCCCGATATGATGAGAGGTAAGATTG -3'
Posted On2016-10-05