Incidental Mutation 'R5490:Star'
ID432044
Institutional Source Beutler Lab
Gene Symbol Star
Ensembl Gene ENSMUSG00000031574
Gene Namesteroidogenic acute regulatory protein
SynonymsD8Ertd419e
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5490 (G1)
Quality Score188
Status Not validated
Chromosome8
Chromosomal Location25806555-25815982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25809917 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 96 (K96E)
Ref Sequence ENSEMBL: ENSMUSP00000148087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033979] [ENSMUST00000210565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033979
AA Change: K96E

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033979
Gene: ENSMUSG00000031574
AA Change: K96E

DomainStartEndE-ValueType
START 75 280 3.63e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210565
AA Change: K96E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to thrive and die during the postnatal period due to adrenocortical insufficiency. Mice exhibit male pseudohermaprhoditism and show a progressive accumulation of lipids within steroidogenic cells of the adrenal glands and gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Star
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Star APN 8 25812866 splice site probably null
IGL01337:Star APN 8 25809864 missense probably damaging 1.00
IGL02165:Star APN 8 25812815 missense possibly damaging 0.75
IGL03274:Star APN 8 25811054 missense possibly damaging 0.72
BB001:Star UTSW 8 25809855 missense possibly damaging 0.72
BB011:Star UTSW 8 25809855 missense possibly damaging 0.72
R1327:Star UTSW 8 25809837 missense probably benign 0.45
R3816:Star UTSW 8 25809877 missense probably benign 0.15
R4790:Star UTSW 8 25808616 missense probably damaging 0.99
R6362:Star UTSW 8 25811807 missense probably benign 0.18
R6964:Star UTSW 8 25811823 missense probably benign 0.00
R7924:Star UTSW 8 25809855 missense possibly damaging 0.72
R8805:Star UTSW 8 25809549 missense probably benign 0.01
R8882:Star UTSW 8 25812869 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATTGGCTAGGACCATTG -3'
(R):5'- TCTTCAGGAGGAAAGGTTATCTG -3'

Sequencing Primer
(F):5'- GATTGGCTAGGACCATTGTACCC -3'
(R):5'- TGGCTAGCCTGGAACTTGCTAC -3'
Posted On2016-10-05