Incidental Mutation 'R5490:Olfr348'
ID432024
Institutional Source Beutler Lab
Gene Symbol Olfr348
Ensembl Gene ENSMUSG00000049315
Gene Nameolfactory receptor 348
SynonymsGA_x6K02T2NLDC-33481050-33481991, MOR136-8
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36784276-36789998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36787181 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 219 (Y219N)
Ref Sequence ENSEMBL: ENSMUSP00000150343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056865] [ENSMUST00000112950] [ENSMUST00000213498] [ENSMUST00000214909] [ENSMUST00000215199] [ENSMUST00000216753] [ENSMUST00000217041]
Predicted Effect probably damaging
Transcript: ENSMUST00000056865
AA Change: Y219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054037
Gene: ENSMUSG00000049315
AA Change: Y219N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 2.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112950
AA Change: Y219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108572
Gene: ENSMUSG00000111021
AA Change: Y219N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 3.5e-34 PFAM
Pfam:7tm_4 140 284 3.9e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213498
AA Change: Y219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214909
AA Change: Y219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215199
AA Change: Y219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216753
Predicted Effect probably benign
Transcript: ENSMUST00000217041
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Olfr348
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr348 APN 2 36787355 missense probably benign 0.03
IGL01943:Olfr348 APN 2 36787083 missense probably benign 0.13
IGL02030:Olfr348 APN 2 36787398 missense probably damaging 1.00
IGL02338:Olfr348 APN 2 36786545 nonsense probably null
IGL02349:Olfr348 APN 2 36787046 missense possibly damaging 0.95
IGL02695:Olfr348 APN 2 36787320 missense possibly damaging 0.72
IGL03004:Olfr348 APN 2 36787182 missense probably damaging 1.00
IGL03007:Olfr348 APN 2 36786800 missense probably damaging 0.99
IGL03024:Olfr348 APN 2 36786846 missense possibly damaging 0.55
R0360:Olfr348 UTSW 2 36787440 missense probably benign 0.03
R0388:Olfr348 UTSW 2 36786862 missense probably benign 0.43
R0614:Olfr348 UTSW 2 36786693 missense probably damaging 1.00
R1498:Olfr348 UTSW 2 36787346 missense probably damaging 1.00
R1562:Olfr348 UTSW 2 36786684 missense probably damaging 1.00
R2882:Olfr348 UTSW 2 36787190 missense probably damaging 1.00
R3731:Olfr348 UTSW 2 36786566 missense possibly damaging 0.53
R4513:Olfr348 UTSW 2 36786770 missense probably benign 0.05
R4899:Olfr348 UTSW 2 36786798 missense probably benign 0.04
R5005:Olfr348 UTSW 2 36787358 missense probably benign
R5035:Olfr348 UTSW 2 36786891 missense probably damaging 1.00
R6361:Olfr348 UTSW 2 36786780 missense probably damaging 1.00
R7762:Olfr348 UTSW 2 36787010 missense probably benign 0.03
R8109:Olfr348 UTSW 2 36786606 missense probably benign 0.00
R8223:Olfr348 UTSW 2 36787397 missense
R8826:Olfr348 UTSW 2 36786843 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCATTTGCTGGTGCCCTTG -3'
(R):5'- GGGATTCAACATGGGTGTGAC -3'

Sequencing Primer
(F):5'- TGGTGCCCTTGTGCACAC -3'
(R):5'- GGTGTGACCATAGTGTACATCAC -3'
Posted On2016-10-05