Incidental Mutation 'R5476:Vmn1r175'
ID434079
Institutional Source Beutler Lab
Gene Symbol Vmn1r175
Ensembl Gene ENSMUSG00000095632
Gene Namevomeronasal 1 receptor 175
SynonymsGm6299
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23807182-23810643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23809131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 24 (V24I)
Ref Sequence ENSEMBL: ENSMUSP00000154170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166141] [ENSMUST00000228383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166141
AA Change: V24I

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126357
Gene: ENSMUSG00000095632
AA Change: V24I

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 8.8e-15 PFAM
Pfam:7tm_1 13 285 2.5e-6 PFAM
Pfam:V1R 41 295 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228383
AA Change: V24I

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Vmn1r175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02944:Vmn1r175 APN 7 23809166 missense probably damaging 0.97
PIT4531001:Vmn1r175 UTSW 7 23809178 missense possibly damaging 0.62
R1163:Vmn1r175 UTSW 7 23808512 missense probably benign 0.30
R1901:Vmn1r175 UTSW 7 23808793 missense probably benign 0.00
R1926:Vmn1r175 UTSW 7 23809041 missense possibly damaging 0.81
R1957:Vmn1r175 UTSW 7 23808383 missense probably benign 0.21
R2163:Vmn1r175 UTSW 7 23808927 missense probably benign 0.29
R2381:Vmn1r175 UTSW 7 23808668 missense probably benign 0.31
R3109:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R3419:Vmn1r175 UTSW 7 23808650 missense probably damaging 0.96
R3941:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R4982:Vmn1r175 UTSW 7 23809069 missense possibly damaging 0.61
R5191:Vmn1r175 UTSW 7 23809022 missense possibly damaging 0.91
R5326:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5333:Vmn1r175 UTSW 7 23808579 missense possibly damaging 0.69
R5542:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5761:Vmn1r175 UTSW 7 23808480 missense probably benign 0.01
R5918:Vmn1r175 UTSW 7 23808947 missense probably damaging 1.00
R6163:Vmn1r175 UTSW 7 23809166 missense possibly damaging 0.71
R6563:Vmn1r175 UTSW 7 23808605 missense possibly damaging 0.61
R7476:Vmn1r175 UTSW 7 23808422 missense probably benign 0.01
R7616:Vmn1r175 UTSW 7 23808606 missense possibly damaging 0.79
R8100:Vmn1r175 UTSW 7 23808587 missense probably damaging 1.00
R8157:Vmn1r175 UTSW 7 23809098 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGTACTTCGAGCCACCAG -3'
(R):5'- AAGTAGAGCTGCCCTTCGTG -3'

Sequencing Primer
(F):5'- CCAAGTTTACATTTTAGGTCAGTTGG -3'
(R):5'- CCTTCGTGGGGGAAAATGTC -3'
Posted On2016-10-06