Incidental Mutation 'R5556:Sh3d21'
ID435376
Institutional Source Beutler Lab
Gene Symbol Sh3d21
Ensembl Gene ENSMUSG00000073758
Gene NameSH3 domain containing 21
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126150602-126163491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126162236 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 126 (N126D)
Ref Sequence ENSEMBL: ENSMUSP00000095501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080919] [ENSMUST00000094760] [ENSMUST00000097891] [ENSMUST00000163176]
Predicted Effect probably benign
Transcript: ENSMUST00000080919
SMART Domains Protein: ENSMUSP00000079722
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 788 1.9e-207 PFAM
low complexity region 790 801 N/A INTRINSIC
low complexity region 835 854 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094760
SMART Domains Protein: ENSMUSP00000092352
Gene: ENSMUSG00000073758

DomainStartEndE-ValueType
SH3 68 125 7.11e-22 SMART
low complexity region 211 221 N/A INTRINSIC
low complexity region 464 473 N/A INTRINSIC
coiled coil region 482 510 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097891
AA Change: N126D

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095501
Gene: ENSMUSG00000073758
AA Change: N126D

DomainStartEndE-ValueType
SH3 1 57 4.29e-7 SMART
low complexity region 66 76 N/A INTRINSIC
SH3 86 141 2.96e-19 SMART
SH3 184 241 7.11e-22 SMART
low complexity region 327 337 N/A INTRINSIC
low complexity region 580 589 N/A INTRINSIC
coiled coil region 598 626 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154702
Predicted Effect probably benign
Transcript: ENSMUST00000163176
Predicted Effect probably benign
Transcript: ENSMUST00000163459
SMART Domains Protein: ENSMUSP00000129775
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 39 4e-17 PFAM
low complexity region 41 58 N/A INTRINSIC
low complexity region 59 77 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
Pfam:Btz 124 192 3.1e-4 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Sh3d21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Sh3d21 APN 4 126152360 missense probably benign
IGL02869:Sh3d21 APN 4 126162241 missense probably benign 0.23
R0827:Sh3d21 UTSW 4 126152271 unclassified probably benign
R0834:Sh3d21 UTSW 4 126151272 missense probably benign 0.02
R0890:Sh3d21 UTSW 4 126151152 missense probably damaging 1.00
R1519:Sh3d21 UTSW 4 126151726 nonsense probably null
R1864:Sh3d21 UTSW 4 126150936 critical splice acceptor site probably null
R1986:Sh3d21 UTSW 4 126162497 missense probably damaging 1.00
R3429:Sh3d21 UTSW 4 126162832 missense probably benign 0.25
R3430:Sh3d21 UTSW 4 126162832 missense probably benign 0.25
R4244:Sh3d21 UTSW 4 126150718 unclassified probably benign
R4501:Sh3d21 UTSW 4 126162859 frame shift probably null
R4972:Sh3d21 UTSW 4 126152416 missense possibly damaging 0.64
R5117:Sh3d21 UTSW 4 126151872 missense probably damaging 1.00
R5249:Sh3d21 UTSW 4 126162065 unclassified probably benign
R5293:Sh3d21 UTSW 4 126152257 missense probably benign 0.18
R7085:Sh3d21 UTSW 4 126163091 missense probably benign 0.02
R7247:Sh3d21 UTSW 4 126152115 missense probably benign 0.00
R7564:Sh3d21 UTSW 4 126151144 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCCAAGGCCTGCAGAAGAAG -3'
(R):5'- GCTGCAGCTATTCACACAGAAG -3'

Sequencing Primer
(F):5'- CCTGCAGAAGAAGAATCGATGGTG -3'
(R):5'- TGCAGCTATTCACACAGAAGAAAGTG -3'
Posted On2016-10-24