Incidental Mutation 'R5557:Zfp608'
ID435481
Institutional Source Beutler Lab
Gene Symbol Zfp608
Ensembl Gene ENSMUSG00000052713
Gene Namezinc finger protein 608
Synonyms4932417D18Rik
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R5557 (G1)
Quality Score166
Status Validated
Chromosome18
Chromosomal Location54888045-54990180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54987870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000068192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064763]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064763
AA Change: D215G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068192
Gene: ENSMUSG00000052713
AA Change: D215G

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 459 471 N/A INTRINSIC
ZnF_C2H2 552 577 1.86e0 SMART
low complexity region 624 636 N/A INTRINSIC
low complexity region 706 718 N/A INTRINSIC
low complexity region 734 773 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 833 846 N/A INTRINSIC
low complexity region 934 956 N/A INTRINSIC
coiled coil region 1028 1054 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1255 1268 N/A INTRINSIC
low complexity region 1439 1450 N/A INTRINSIC
low complexity region 1458 1466 N/A INTRINSIC
low complexity region 1486 1502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181829
Meta Mutation Damage Score 0.0776 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Zfp608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Zfp608 APN 18 54988333 missense probably benign
IGL00920:Zfp608 APN 18 54889831 missense probably benign 0.00
IGL01088:Zfp608 APN 18 54898087 missense probably benign 0.03
IGL01447:Zfp608 APN 18 54899011 missense possibly damaging 0.75
IGL01534:Zfp608 APN 18 54898932 missense probably damaging 0.99
IGL01547:Zfp608 APN 18 54894449 critical splice donor site probably null
IGL01933:Zfp608 APN 18 54987799 missense probably benign
IGL01998:Zfp608 APN 18 54891818 missense probably damaging 0.99
IGL02167:Zfp608 APN 18 54988224 missense probably damaging 1.00
IGL02266:Zfp608 APN 18 54897581 missense probably benign 0.08
IGL02335:Zfp608 APN 18 54897437 nonsense probably null
IGL02455:Zfp608 APN 18 54899333 missense probably damaging 1.00
IGL02612:Zfp608 APN 18 54898201 missense probably damaging 1.00
IGL02900:Zfp608 APN 18 54946793 missense probably damaging 1.00
PIT4243001:Zfp608 UTSW 18 54898024 missense probably damaging 1.00
PIT4519001:Zfp608 UTSW 18 54946711 missense possibly damaging 0.71
R0005:Zfp608 UTSW 18 54895520 missense possibly damaging 0.88
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0064:Zfp608 UTSW 18 54898816 missense probably benign
R0401:Zfp608 UTSW 18 54898994 missense probably benign
R0722:Zfp608 UTSW 18 54900234 missense probably damaging 1.00
R1351:Zfp608 UTSW 18 54898391 missense probably benign 0.00
R1512:Zfp608 UTSW 18 54946666 missense probably damaging 1.00
R1554:Zfp608 UTSW 18 54898054 missense probably damaging 1.00
R1622:Zfp608 UTSW 18 54988294 missense probably benign 0.07
R1669:Zfp608 UTSW 18 54987739 missense probably benign 0.09
R1690:Zfp608 UTSW 18 54987634 missense possibly damaging 0.62
R1721:Zfp608 UTSW 18 54899249 missense probably benign
R1826:Zfp608 UTSW 18 54898576 missense probably benign 0.03
R1864:Zfp608 UTSW 18 54897911 missense probably benign 0.00
R1952:Zfp608 UTSW 18 54897779 nonsense probably null
R2049:Zfp608 UTSW 18 54895565 missense probably damaging 1.00
R2051:Zfp608 UTSW 18 54988314 missense probably benign
R2168:Zfp608 UTSW 18 54898053 nonsense probably null
R2218:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R2283:Zfp608 UTSW 18 54988374 missense probably damaging 1.00
R2399:Zfp608 UTSW 18 54897902 missense probably damaging 1.00
R2520:Zfp608 UTSW 18 54988506 missense possibly damaging 0.92
R2961:Zfp608 UTSW 18 54898472 missense possibly damaging 0.60
R4074:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4076:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4206:Zfp608 UTSW 18 54988195 missense probably damaging 1.00
R4756:Zfp608 UTSW 18 54894472 missense probably damaging 1.00
R4771:Zfp608 UTSW 18 54988300 missense probably benign
R4820:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R4825:Zfp608 UTSW 18 54897969 missense probably benign 0.01
R4912:Zfp608 UTSW 18 54946591 missense probably damaging 1.00
R4975:Zfp608 UTSW 18 54889890 missense probably damaging 1.00
R5138:Zfp608 UTSW 18 54891799 missense probably damaging 1.00
R5192:Zfp608 UTSW 18 54898497 missense probably damaging 1.00
R5624:Zfp608 UTSW 18 54898272 missense probably damaging 1.00
R5818:Zfp608 UTSW 18 54895396 missense probably benign 0.02
R5840:Zfp608 UTSW 18 54898906 missense probably damaging 1.00
R5992:Zfp608 UTSW 18 54899248 missense probably benign 0.15
R6106:Zfp608 UTSW 18 54987872 missense possibly damaging 0.54
R6174:Zfp608 UTSW 18 54988544 start gained probably benign
R6181:Zfp608 UTSW 18 54895628 missense possibly damaging 0.56
R6517:Zfp608 UTSW 18 54899078 missense possibly damaging 0.94
R6567:Zfp608 UTSW 18 54897556 missense probably damaging 1.00
R6668:Zfp608 UTSW 18 54898019 missense probably damaging 1.00
R6920:Zfp608 UTSW 18 54988265 missense probably damaging 1.00
R7061:Zfp608 UTSW 18 54987997 missense probably benign
R7074:Zfp608 UTSW 18 54897382 missense possibly damaging 0.69
R7087:Zfp608 UTSW 18 54899397 missense probably damaging 1.00
R7391:Zfp608 UTSW 18 54897547 missense possibly damaging 0.49
R7600:Zfp608 UTSW 18 54988020 missense probably damaging 1.00
R7723:Zfp608 UTSW 18 54897601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGAGTTTCCCATGAGCGTTG -3'
(R):5'- TGGCATGAATTCAGCGCTG -3'

Sequencing Primer
(F):5'- GAGTTTCCCATGAGCGTTGAATCC -3'
(R):5'- TTCAGCGCTGGGTCAAAG -3'
Posted On2016-10-24