Incidental Mutation 'R5648:Epha4'
ID441253
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene NameEph receptor A4
Synonymsrb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1
MMRRC Submission 043169-MU
Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location77367185-77515088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77398525 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 562 (I562V)
Ref Sequence ENSEMBL: ENSMUSP00000139640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000186930] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
PDB Structure
THE CRYSTAL STRUCTURE OF AN EPH RECEPTOR SAM DOMAIN REVEALS A MECHANISM FOR MODULAR DIMERIZATION. [X-RAY DIFFRACTION]
Crystal structure of a mutant EphA4 kinase domain (Y742A) [X-RAY DIFFRACTION]
[]
Crystal structure of EphA4 kinase domain in complex with VUF 12058 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF EPHA4 KINASE DOMAIN [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with Dasatinib. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027451
AA Change: I562V

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: I562V

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186930
SMART Domains Protein: ENSMUSP00000140370
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 33 124 9.6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188797
AA Change: I562V

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: I562V

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188952
AA Change: I562V

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: I562V

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189934
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77398557 missense probably benign 0.00
IGL01350:Epha4 APN 1 77506855 missense probably damaging 1.00
IGL01657:Epha4 APN 1 77426838 missense probably damaging 1.00
IGL01872:Epha4 APN 1 77383039 missense probably benign 0.03
IGL02366:Epha4 APN 1 77426711 nonsense probably null
IGL02426:Epha4 APN 1 77444877 missense probably benign 0.01
IGL02428:Epha4 APN 1 77506748 missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77426845 missense probably damaging 1.00
IGL02716:Epha4 APN 1 77380965 missense probably damaging 1.00
IGL03348:Epha4 APN 1 77507172 missense possibly damaging 0.82
frog UTSW 1 77481076 intron probably benign
R0324:Epha4 UTSW 1 77383551 missense probably damaging 1.00
R0392:Epha4 UTSW 1 77506973 missense probably benign 0.00
R0538:Epha4 UTSW 1 77388541 missense probably damaging 1.00
R0562:Epha4 UTSW 1 77388487 missense probably benign 0.00
R0885:Epha4 UTSW 1 77382939 missense probably damaging 0.99
R1509:Epha4 UTSW 1 77380886 missense probably damaging 1.00
R1620:Epha4 UTSW 1 77374926 missense probably benign 0.31
R1624:Epha4 UTSW 1 77399692 missense probably damaging 1.00
R1654:Epha4 UTSW 1 77374768 splice site probably null
R1755:Epha4 UTSW 1 77387823 missense probably damaging 1.00
R1807:Epha4 UTSW 1 77374904 missense probably benign 0.05
R2046:Epha4 UTSW 1 77507162 missense probably damaging 1.00
R2504:Epha4 UTSW 1 77382991 missense probably damaging 1.00
R2509:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R3441:Epha4 UTSW 1 77426696 missense possibly damaging 0.90
R3724:Epha4 UTSW 1 77426543 splice site probably benign
R3901:Epha4 UTSW 1 77380902 missense probably damaging 1.00
R3950:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3951:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3952:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R4012:Epha4 UTSW 1 77390094 splice site probably benign
R4321:Epha4 UTSW 1 77507213 critical splice acceptor site probably null
R4422:Epha4 UTSW 1 77511717 missense probably damaging 0.99
R4898:Epha4 UTSW 1 77390075 nonsense probably null
R5072:Epha4 UTSW 1 77445002 missense probably damaging 1.00
R5270:Epha4 UTSW 1 77506607 missense probably damaging 1.00
R5281:Epha4 UTSW 1 77374867 missense probably benign
R5315:Epha4 UTSW 1 77388472 critical splice donor site probably null
R5531:Epha4 UTSW 1 77374876 missense probably benign
R5621:Epha4 UTSW 1 77515049 utr 5 prime probably benign
R5747:Epha4 UTSW 1 77506883 missense probably damaging 0.99
R5829:Epha4 UTSW 1 77444994 missense probably benign 0.01
R6185:Epha4 UTSW 1 77507106 missense probably damaging 1.00
R6486:Epha4 UTSW 1 77383549 missense probably damaging 1.00
R6821:Epha4 UTSW 1 77382945 missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77377583 missense probably damaging 1.00
R7039:Epha4 UTSW 1 77506785 missense probably damaging 1.00
R7216:Epha4 UTSW 1 77444984 missense probably damaging 1.00
R7270:Epha4 UTSW 1 77399785 missense probably damaging 1.00
R7444:Epha4 UTSW 1 77387916 missense probably damaging 1.00
R7737:Epha4 UTSW 1 77381012 missense probably damaging 1.00
R7763:Epha4 UTSW 1 77390031 critical splice donor site probably null
R7950:Epha4 UTSW 1 77507196 missense probably damaging 0.99
R8297:Epha4 UTSW 1 77506910 missense probably damaging 1.00
R8373:Epha4 UTSW 1 77507079 missense possibly damaging 0.60
R8429:Epha4 UTSW 1 77390036 missense probably benign 0.08
Z1088:Epha4 UTSW 1 77506662 missense possibly damaging 0.61
Z1176:Epha4 UTSW 1 77373733 makesense probably null
Z1176:Epha4 UTSW 1 77383011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGCTGTCAGATGGCAATG -3'
(R):5'- GATTTGCCTAATGGATGCTGTGAC -3'

Sequencing Primer
(F):5'- CTGTCAGATGGCAATGCTCAG -3'
(R):5'- ATGCTGTGACATGGATTTGCTAAC -3'
Posted On2016-11-08