Incidental Mutation 'R5779:Ifrd1'
ID446889
Institutional Source Beutler Lab
Gene Symbol Ifrd1
Ensembl Gene ENSMUSG00000001627
Gene Nameinterferon-related developmental regulator 1
SynonymsTis7, PC4, Ifnl
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.581) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location40201567-40248504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40203370 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 448 (F448I)
Ref Sequence ENSEMBL: ENSMUSP00000001672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001672] [ENSMUST00000095760] [ENSMUST00000165027] [ENSMUST00000171530] [ENSMUST00000220951]
Predicted Effect probably damaging
Transcript: ENSMUST00000001672
AA Change: F448I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001672
Gene: ENSMUSG00000001627
AA Change: F448I

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
Pfam:IFRD 40 345 1.1e-115 PFAM
Pfam:IFRD_C 390 443 6.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095760
SMART Domains Protein: ENSMUSP00000093434
Gene: ENSMUSG00000071342

DomainStartEndE-ValueType
Pfam:DUF4577 1 128 1.5e-73 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164047
AA Change: F84I
SMART Domains Protein: ENSMUSP00000127553
Gene: ENSMUSG00000001627
AA Change: F84I

DomainStartEndE-ValueType
Pfam:IFRD 1 25 9.3e-11 PFAM
Pfam:IFRD_C 27 80 5.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164804
Predicted Effect unknown
Transcript: ENSMUST00000165027
AA Change: F400I
SMART Domains Protein: ENSMUSP00000133028
Gene: ENSMUSG00000001627
AA Change: F400I

DomainStartEndE-ValueType
Pfam:IFRD 1 119 8.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170119
Predicted Effect probably benign
Transcript: ENSMUST00000171530
SMART Domains Protein: ENSMUSP00000128635
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
Pfam:IFRD 40 137 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220951
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display impaired muscle regeneration and myogenic differentiation and decreased body weight in older mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Ifrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Ifrd1 APN 12 40214093 missense probably benign 0.00
IGL02442:Ifrd1 APN 12 40216317 splice site probably benign
IGL02942:Ifrd1 APN 12 40217376 critical splice donor site probably null
IGL03119:Ifrd1 APN 12 40212334 missense probably null 0.03
R0107:Ifrd1 UTSW 12 40214081 missense probably damaging 1.00
R0138:Ifrd1 UTSW 12 40207130 splice site probably benign
R0390:Ifrd1 UTSW 12 40214094 splice site probably null
R0627:Ifrd1 UTSW 12 40206987 critical splice donor site probably null
R2061:Ifrd1 UTSW 12 40213245 missense probably benign 0.00
R5915:Ifrd1 UTSW 12 40213096 missense possibly damaging 0.94
R6000:Ifrd1 UTSW 12 40216244 missense possibly damaging 0.52
R6539:Ifrd1 UTSW 12 40203435 missense probably damaging 1.00
R6751:Ifrd1 UTSW 12 40203914 splice site probably null
R6800:Ifrd1 UTSW 12 40223158 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCTCACTACACAGAATACG -3'
(R):5'- TGATGTGTGCCTGTTACCTC -3'

Sequencing Primer
(F):5'- CAAACACTTTATTTGTGGTTACCAG -3'
(R):5'- GATGTGTGCCTGTTACCTCTCTAG -3'
Posted On2016-12-15