Incidental Mutation 'R5811:Gjd3'
ID447524
Institutional Source Beutler Lab
Gene Symbol Gjd3
Ensembl Gene ENSMUSG00000047197
Gene Namegap junction protein, delta 3
Synonymsconnexin 30.2, connexin-30.2, Gja11, Gjc1, cx30.2
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5811 (G1)
Quality Score158
Status Not validated
Chromosome11
Chromosomal Location98982180-98983016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98982400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 206 (V206E)
Ref Sequence ENSEMBL: ENSMUSP00000055246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062931
AA Change: V206E

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055246
Gene: ENSMUSG00000047197
AA Change: V206E

DomainStartEndE-ValueType
CNX 43 76 1.85e-14 SMART
Connexin_CCC 146 212 3.14e-35 SMART
low complexity region 222 234 N/A INTRINSIC
low complexity region 251 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the large family of connexins that are required for the formation of gap junctions. Six connexin monomers form a hemichannel, or connexon, on the cell surface. This connexon can interact with a connexon from a neighboring cell, thus forming a channel linking the cytoplasm of the 2 cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accelerated atrioventricular nodal conduction velocity in the heart but no significant alterations in excitability or fast network oscillations in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Gjd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Gjd3 APN 11 98982761 missense probably damaging 1.00
R1642:Gjd3 UTSW 11 98982709 missense probably benign 0.01
R2267:Gjd3 UTSW 11 98982401 missense probably damaging 0.98
R4397:Gjd3 UTSW 11 98982421 missense probably damaging 1.00
R7578:Gjd3 UTSW 11 98982475 missense probably damaging 0.99
R7657:Gjd3 UTSW 11 98982760 nonsense probably null
R8544:Gjd3 UTSW 11 98982662 nonsense probably null
R8704:Gjd3 UTSW 11 98982619 missense probably damaging 1.00
R8778:Gjd3 UTSW 11 98983016 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- AAAGCCTTCTGCCTCCAAG -3'
(R):5'- TCATCTACTCCATGCACCAGG -3'

Sequencing Primer
(F):5'- AAGGACCCGGGTGCTGATATC -3'
(R):5'- TGCTACCTGCTGAGCGTG -3'
Posted On2016-12-15