Incidental Mutation 'R0552:Olfr482'
ID45237
Institutional Source Beutler Lab
Gene Symbol Olfr482
Ensembl Gene ENSMUSG00000059031
Gene Nameolfactory receptor 482
SynonymsMOR204-14, GA_x6K02T2PBJ9-10424354-10423383
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R0552 (G1)
Quality Score188
Status Not validated
Chromosome7
Chromosomal Location108092999-108097586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108094778 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 264 (M264T)
Ref Sequence ENSEMBL: ENSMUSP00000150755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081184] [ENSMUST00000217304]
Predicted Effect probably benign
Transcript: ENSMUST00000081184
AA Change: M264T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079948
Gene: ENSMUSG00000059031
AA Change: M264T

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.2e-52 PFAM
Pfam:7tm_1 44 293 8.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207291
Predicted Effect probably benign
Transcript: ENSMUST00000217304
AA Change: M264T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Olfr482
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Olfr482 APN 7 108094839 missense probably damaging 1.00
IGL01482:Olfr482 APN 7 108095486 missense probably benign 0.01
IGL01710:Olfr482 APN 7 108095242 missense probably benign 0.00
IGL02064:Olfr482 APN 7 108095247 missense probably benign 0.20
IGL02930:Olfr482 APN 7 108095414 missense probably damaging 1.00
IGL03206:Olfr482 APN 7 108095054 missense probably damaging 1.00
IGL03255:Olfr482 APN 7 108094817 missense probably damaging 1.00
R0378:Olfr482 UTSW 7 108095222 missense probably benign 0.10
R1538:Olfr482 UTSW 7 108095286 missense probably damaging 1.00
R1771:Olfr482 UTSW 7 108095609 splice site probably null
R1939:Olfr482 UTSW 7 108095141 missense probably benign 0.06
R2258:Olfr482 UTSW 7 108095195 missense possibly damaging 0.95
R4169:Olfr482 UTSW 7 108095384 missense probably damaging 1.00
R4170:Olfr482 UTSW 7 108095073 missense probably benign 0.00
R4485:Olfr482 UTSW 7 108095015 missense probably benign
R4803:Olfr482 UTSW 7 108095459 missense probably damaging 0.99
R4887:Olfr482 UTSW 7 108095096 missense probably benign 0.18
R5059:Olfr482 UTSW 7 108095315 missense probably damaging 1.00
R5445:Olfr482 UTSW 7 108094742 missense possibly damaging 0.69
R5539:Olfr482 UTSW 7 108095226 missense probably benign 0.23
R5644:Olfr482 UTSW 7 108094804 nonsense probably null
R6200:Olfr482 UTSW 7 108095525 frame shift probably null
R7171:Olfr482 UTSW 7 108095135 missense probably benign 0.00
R8024:Olfr482 UTSW 7 108095289 missense probably benign 0.19
X0021:Olfr482 UTSW 7 108094959 missense probably benign 0.20
Z1176:Olfr482 UTSW 7 108094994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGATCCTTCATGGGACGCGCTG -3'
(R):5'- TCCACACAAGTCTGTGTCAAGTTGG -3'

Sequencing Primer
(F):5'- GCTCTCCAAGGTACAATTGC -3'
(R):5'- AATTTGCTCTTCTGTGGACCAAAC -3'
Posted On2013-06-11