Incidental Mutation 'IGL02991:Chd7'
ID452909
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Namechromodomain helicase DNA binding protein 7
SynonymsA730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #IGL02991 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location8690406-8867659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8828398 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1113 (M1113T)
Ref Sequence ENSEMBL: ENSMUSP00000059079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039267
AA Change: M1113T

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: M1113T

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000051558
AA Change: M1113T

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: M1113T

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Meta Mutation Damage Score 0.2062 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adam23 T C 1: 63,547,819 probably null Het
Aptx C A 4: 40,686,687 G199C probably damaging Het
Asap2 T C 12: 21,249,293 probably benign Het
Atp11b A G 3: 35,826,991 T566A probably benign Het
Bcas3 C T 11: 85,457,887 Q202* probably null Het
Cacna1h C A 17: 25,391,312 R740L possibly damaging Het
Casp8 T A 1: 58,827,279 N146K probably benign Het
Ccdc63 T C 5: 122,108,212 M549V probably benign Het
Cdc45 C T 16: 18,798,729 M200I probably benign Het
Cdh20 T C 1: 104,934,247 S51P probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 ACC AC 1: 139,237,084 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cxcl11 C T 5: 92,361,310 R28H probably damaging Het
Defb40 C T 8: 18,975,103 C29Y probably damaging Het
Fam105a T C 15: 27,658,302 S211G possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fen1 A T 19: 10,200,662 D139E probably benign Het
Frem3 A G 8: 80,668,882 E1846G probably damaging Het
Gria2 T A 3: 80,707,809 K455* probably null Het
Hmcn1 A T 1: 150,738,658 N1332K possibly damaging Het
Htr5b C T 1: 121,528,027 V55M probably benign Het
Ighv6-5 A T 12: 114,416,695 N86K probably benign Het
Il4ra T C 7: 125,575,661 V347A possibly damaging Het
Itih5 A G 2: 10,251,351 E876G probably benign Het
Itpkb A T 1: 180,327,714 probably benign Het
Lbr T C 1: 181,821,552 Y334C probably damaging Het
Lrfn2 T C 17: 49,070,704 L271P probably damaging Het
Lss T A 10: 76,543,911 probably benign Het
Map1a T C 2: 121,301,610 V731A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3b T A 4: 35,083,805 Q128L probably benign Het
Mog T C 17: 37,023,199 M1V probably null Het
Mrpl4 A G 9: 21,008,605 Y284C probably damaging Het
Mtus2 T G 5: 148,313,500 V310G probably damaging Het
Mup11 ACAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCA 4: 60,662,276 probably benign Het
Olfr972 T A 9: 39,874,066 S264T probably benign Het
Olfr979 T C 9: 40,000,402 Y275C probably damaging Het
Orc3 T G 4: 34,593,083 Q328P probably damaging Het
Pcdhb20 G T 18: 37,506,211 G597C probably damaging Het
Pdxdc1 A G 16: 13,857,396 I334T probably damaging Het
Ppef2 C T 5: 92,235,900 W450* probably null Het
Proz G A 8: 13,073,490 E254K probably benign Het
Psma6 T C 12: 55,407,572 probably benign Het
Rbm12 C T 2: 156,095,560 probably benign Het
Ryr2 A G 13: 11,761,306 V1115A probably damaging Het
Sfxn5 G T 6: 85,289,208 N102K possibly damaging Het
Sgo2a G T 1: 58,015,355 probably benign Het
Slc14a2 A T 18: 78,205,834 M1K probably null Het
Spag5 T A 11: 78,314,251 L621M probably damaging Het
Spata31 A G 13: 64,920,719 Y227C probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Supt6 T C 11: 78,225,353 E728G probably damaging Het
Sympk T A 7: 19,030,577 L69Q probably damaging Het
Timd4 T A 11: 46,842,147 probably benign Het
Trh G A 6: 92,243,738 R48W probably damaging Het
Trip12 C A 1: 84,738,815 D383Y probably damaging Het
Tspo2 T A 17: 48,449,986 I23F possibly damaging Het
Tspyl5 A G 15: 33,686,843 S319P probably damaging Het
Ttc25 A G 11: 100,553,872 S285G probably benign Het
Txlnb A G 10: 17,841,453 K403E probably damaging Het
Vmn2r34 C A 7: 7,672,721 C556F probably damaging Het
Vps13c C A 9: 67,913,877 A1223E probably damaging Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0388:Chd7 UTSW 4 8854560 missense probably benign 0.27
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0799:Chd7 UTSW 4 8801310 intron probably benign
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1605:Chd7 UTSW 4 8844675 missense probably damaging 1.00
R1693:Chd7 UTSW 4 8864307 critical splice donor site probably null
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2134:Chd7 UTSW 4 8753147 missense probably damaging 0.99
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8844417 missense probably damaging 1.00
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
R7288:Chd7 UTSW 4 8847093 missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8752196 missense unknown
R7452:Chd7 UTSW 4 8854731 missense probably benign 0.03
R7471:Chd7 UTSW 4 8859197 missense probably damaging 0.96
R7588:Chd7 UTSW 4 8864039 missense probably damaging 1.00
R7711:Chd7 UTSW 4 8805234
Predicted Primers PCR Primer
(F):5'- GAACATAGCCAGTCCTGTGAAAC -3'
(R):5'- GGCTTGGCCCAACAGTTAATG -3'

Sequencing Primer
(F):5'- TGTGAAACAGCTCTCACGTG -3'
(R):5'- CTTGGCCCAACAGTTAATGACATGG -3'
Posted On2017-01-24