Incidental Mutation 'R5944:Dcaf13'
ID 460496
Institutional Source Beutler Lab
Gene Symbol Dcaf13
Ensembl Gene ENSMUSG00000022300
Gene Name DDB1 and CUL4 associated factor 13
Synonyms LOC223499, Wdsof1
MMRRC Submission 044136-MU
Accession Numbers

Genbank: NM_198606; MGI: 2684929

Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R5944 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 39112865-39146856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 39146677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 419 (M419L)
Ref Sequence ENSEMBL: ENSMUSP00000022909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022909]
AlphaFold Q6PAC3
Predicted Effect probably benign
Transcript: ENSMUST00000022909
AA Change: M419L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022909
Gene: ENSMUSG00000022300
AA Change: M419L

DomainStartEndE-ValueType
WD40 55 95 5.77e-5 SMART
WD40 98 137 4.38e-5 SMART
WD40 185 225 5.97e-1 SMART
Blast:WD40 228 267 1e-18 BLAST
WD40 271 310 2.69e-5 SMART
WD40 312 353 2.96e-2 SMART
Pfam:Sof1 354 440 7.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227219
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Dcaf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Dcaf13 APN 15 39143632 nonsense probably null
IGL01081:Dcaf13 APN 15 39118806 missense probably damaging 1.00
IGL01766:Dcaf13 APN 15 39118750 missense probably benign 0.00
IGL02174:Dcaf13 APN 15 39138149 missense probably damaging 1.00
IGL02262:Dcaf13 APN 15 39118707 splice site probably benign
IGL02740:Dcaf13 APN 15 39145100 nonsense probably null
IGL03092:Dcaf13 APN 15 39127976 splice site probably benign
IGL03374:Dcaf13 APN 15 39145148 nonsense probably null
R0590:Dcaf13 UTSW 15 39145085 splice site probably benign
R0594:Dcaf13 UTSW 15 39123268 missense probably benign 0.00
R0711:Dcaf13 UTSW 15 39138089 missense probably damaging 1.00
R1036:Dcaf13 UTSW 15 39143718 missense probably damaging 1.00
R1770:Dcaf13 UTSW 15 39130238 missense probably damaging 1.00
R1826:Dcaf13 UTSW 15 39118899 missense probably damaging 1.00
R1933:Dcaf13 UTSW 15 39138088 missense probably damaging 0.99
R2508:Dcaf13 UTSW 15 39145152 missense probably benign
R4113:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
R4595:Dcaf13 UTSW 15 39118893 missense probably damaging 1.00
R4649:Dcaf13 UTSW 15 39138242 missense possibly damaging 0.54
R5431:Dcaf13 UTSW 15 39123224 missense probably benign 0.16
R5454:Dcaf13 UTSW 15 39124364 missense probably benign
R5834:Dcaf13 UTSW 15 39143642 nonsense probably null
R5929:Dcaf13 UTSW 15 39143653 missense possibly damaging 0.89
R6319:Dcaf13 UTSW 15 39143672 missense probably benign 0.00
R6394:Dcaf13 UTSW 15 39143737 missense probably benign 0.04
R6664:Dcaf13 UTSW 15 39118888 missense probably damaging 1.00
R6884:Dcaf13 UTSW 15 39123240 missense probably damaging 1.00
R7419:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
R8750:Dcaf13 UTSW 15 39119441 missense probably damaging 1.00
R8944:Dcaf13 UTSW 15 39138217 missense possibly damaging 0.79
R9294:Dcaf13 UTSW 15 39130292 missense possibly damaging 0.92
R9300:Dcaf13 UTSW 15 39146707 missense probably damaging 1.00
Z1088:Dcaf13 UTSW 15 39145247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAAACTTAGTAAGGGATGCTGGG -3'
(R):5'- AGCTGGCTCTTAGATCAGTGC -3'

Sequencing Primer
(F):5'- GCATGCAGCACTAAGGTGTATTCC -3'
(R):5'- CTGGCTCTTAGATCAGTGCAAGTAG -3'
Posted On 2017-02-28