Incidental Mutation 'R5176:March9'
ID462797
Institutional Source Beutler Lab
Gene Symbol March9
Ensembl Gene ENSMUSG00000040502
Gene Namemembrane-associated ring finger (C3HC4) 9
Synonyms
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5176 (G1)
Quality Score44
Status Validated
Chromosome10
Chromosomal Location127055011-127060184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127059450 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000041581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000040307] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]
Predicted Effect probably benign
Transcript: ENSMUST00000006911
SMART Domains Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
S_TKc 6 295 9.2e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040307
AA Change: D102G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502
AA Change: D102G

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
RINGv 109 156 7.51e-18 SMART
transmembrane domain 183 205 N/A INTRINSIC
Blast:AAA 211 238 2e-9 BLAST
low complexity region 267 284 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120226
SMART Domains Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 103 6e-10 PFAM
low complexity region 121 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123456
Predicted Effect probably benign
Transcript: ENSMUST00000125682
SMART Domains Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
S_TKc 6 261 5.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133115
SMART Domains Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
S_TKc 6 250 1.55e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140254
Predicted Effect probably benign
Transcript: ENSMUST00000142558
SMART Domains Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 74 1.6e-8 PFAM
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH9 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH9 induces internalization of several membrane glycoproteins and directs them to the endosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Hoer et al., 2007 [PubMed 17174307]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in March9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:March9 APN 10 127057590 missense probably damaging 1.00
IGL01433:March9 APN 10 127056693 missense probably benign 0.26
R5681:March9 UTSW 10 127058303 missense probably benign 0.17
R6526:March9 UTSW 10 127056689 missense probably benign 0.01
R7328:March9 UTSW 10 127058296 missense probably damaging 1.00
R7673:March9 UTSW 10 127056599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGACACACTCCAGGAGTC -3'
(R):5'- GTTCCTGAACGAGCTGAAGC -3'

Sequencing Primer
(F):5'- ACTCCAGGAGTCTCCAGC -3'
(R):5'- AAGCTGCTGGTGCTGAC -3'
Posted On2017-03-03