Incidental Mutation 'R5176:Fam160b1'
ID399357
Institutional Source Beutler Lab
Gene Symbol Fam160b1
Ensembl Gene ENSMUSG00000033478
Gene Namefamily with sequence similarity 160, member B1
Synonyms
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location57361009-57389594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57371181 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 51 (N51S)
Ref Sequence ENSEMBL: ENSMUSP00000048903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036407]
Predicted Effect probably damaging
Transcript: ENSMUST00000036407
AA Change: N51S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048903
Gene: ENSMUSG00000033478
AA Change: N51S

DomainStartEndE-ValueType
Pfam:RAI16-like 78 495 1.1e-144 PFAM
low complexity region 713 724 N/A INTRINSIC
Meta Mutation Damage Score 0.1790 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Fam160b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fam160b1 APN 19 57381345 missense probably benign 0.00
IGL02642:Fam160b1 APN 19 57385350 missense possibly damaging 0.55
IGL03152:Fam160b1 APN 19 57378832 missense probably damaging 0.99
fredericksburg UTSW 19 57384123 nonsense probably null
R0001:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R0123:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0368:Fam160b1 UTSW 19 57368578 missense possibly damaging 0.91
R0446:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0508:Fam160b1 UTSW 19 57378742 missense probably benign 0.04
R0926:Fam160b1 UTSW 19 57381090 missense probably damaging 1.00
R1122:Fam160b1 UTSW 19 57382301 missense probably benign 0.00
R1344:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1398:Fam160b1 UTSW 19 57372926 splice site probably benign
R1418:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1506:Fam160b1 UTSW 19 57368575 missense probably benign 0.30
R1530:Fam160b1 UTSW 19 57386305 missense probably damaging 0.99
R1695:Fam160b1 UTSW 19 57379171 missense probably damaging 1.00
R1868:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R1974:Fam160b1 UTSW 19 57385377 missense probably damaging 0.99
R2004:Fam160b1 UTSW 19 57381892 missense probably benign
R2893:Fam160b1 UTSW 19 57384169 missense probably benign 0.01
R3011:Fam160b1 UTSW 19 57385288 missense probably damaging 1.00
R3963:Fam160b1 UTSW 19 57373010 missense possibly damaging 0.77
R4416:Fam160b1 UTSW 19 57385397 splice site probably null
R4613:Fam160b1 UTSW 19 57371187 missense probably damaging 0.99
R4735:Fam160b1 UTSW 19 57371229 missense probably damaging 1.00
R4893:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R4937:Fam160b1 UTSW 19 57378637 missense probably benign
R5049:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R5050:Fam160b1 UTSW 19 57383170 missense probably damaging 1.00
R5080:Fam160b1 UTSW 19 57373281 missense probably damaging 1.00
R5317:Fam160b1 UTSW 19 57381709 splice site probably null
R5347:Fam160b1 UTSW 19 57378619 missense probably benign
R5497:Fam160b1 UTSW 19 57381151 splice site probably null
R5969:Fam160b1 UTSW 19 57384123 nonsense probably null
R6418:Fam160b1 UTSW 19 57381734 missense probably benign 0.18
R6426:Fam160b1 UTSW 19 57383178 missense probably damaging 1.00
R6765:Fam160b1 UTSW 19 57378745 missense probably benign
R7472:Fam160b1 UTSW 19 57368585 missense probably damaging 1.00
R7583:Fam160b1 UTSW 19 57378602 missense probably benign 0.01
R7672:Fam160b1 UTSW 19 57385318 missense possibly damaging 0.95
X0023:Fam160b1 UTSW 19 57384147 nonsense probably null
X0062:Fam160b1 UTSW 19 57385257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACTGACGGGCTATGTTCC -3'
(R):5'- GGAGCTTCACCTGTGTTACAC -3'

Sequencing Primer
(F):5'- CGGGCTATGTTCCAGGAAATG -3'
(R):5'- TGTGTTACACAGAGGGGCAG -3'
Posted On2016-07-06