Incidental Mutation 'R5176:Olfr998'
ID399255
Institutional Source Beutler Lab
Gene Symbol Olfr998
Ensembl Gene ENSMUSG00000111454
Gene Nameolfactory receptor 998
SynonymsGA_x6K02T2Q125-47069356-47070300, MOR175-5
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85588948-85591893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85591435 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 298 (K298N)
Ref Sequence ENSEMBL: ENSMUSP00000150713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052307] [ENSMUST00000215083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052307
AA Change: K298N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059970
Gene: ENSMUSG00000111454
AA Change: K298N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-54 PFAM
Pfam:7tm_1 41 308 9.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215083
AA Change: K298N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Olfr998
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Olfr998 APN 2 85591347 missense probably benign 0.00
R0091:Olfr998 UTSW 2 85591352 missense probably benign 0.38
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0268:Olfr998 UTSW 2 85591301 missense possibly damaging 0.78
R0481:Olfr998 UTSW 2 85591104 missense possibly damaging 0.94
R1816:Olfr998 UTSW 2 85590925 missense probably benign 0.00
R1988:Olfr998 UTSW 2 85590641 missense probably benign 0.00
R2008:Olfr998 UTSW 2 85591422 missense probably damaging 1.00
R2060:Olfr998 UTSW 2 85591283 missense possibly damaging 0.78
R2273:Olfr998 UTSW 2 85590588 missense probably damaging 1.00
R4409:Olfr998 UTSW 2 85590930 missense probably damaging 1.00
R4783:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R4785:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R5098:Olfr998 UTSW 2 85590632 missense probably benign 0.00
R5462:Olfr998 UTSW 2 85591296 missense probably damaging 1.00
R6092:Olfr998 UTSW 2 85590606 missense probably benign 0.14
R6278:Olfr998 UTSW 2 85590998 missense probably benign 0.00
R7022:Olfr998 UTSW 2 85590598 missense probably benign 0.01
R7673:Olfr998 UTSW 2 85591062 missense possibly damaging 0.75
R8054:Olfr998 UTSW 2 85590840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGATTCAAACTGCTGATGGG -3'
(R):5'- ACAGAGGCATTTCAGATAAACTGC -3'

Sequencing Primer
(F):5'- GGGAAACAAAAAGCCTTCTCTACTTG -3'
(R):5'- GGCATTTCAGATAAACTGCATAGAG -3'
Posted On2016-07-06