Incidental Mutation 'R5176:Sipa1'
ID399350
Institutional Source Beutler Lab
Gene Symbol Sipa1
Ensembl Gene ENSMUSG00000056917
Gene Namesignal-induced proliferation associated gene 1
SynonymsSPA-1
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5651185-5663707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5659378 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 310 (S310P)
Ref Sequence ENSEMBL: ENSMUSP00000132345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000164304] [ENSMUST00000169854]
Predicted Effect probably damaging
Transcript: ENSMUST00000071857
AA Change: S310P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917
AA Change: S310P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080824
AA Change: S310P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917
AA Change: S310P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164304
AA Change: S310P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917
AA Change: S310P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169854
AA Change: S310P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917
AA Change: S310P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.2460 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a mitogen induced GTPase activating protein (GAP). It exhibits a specific GAP activity for Ras-related regulatory proteins Rap1 and Rap2, but not for Ran or other small GTPases. This protein may also hamper mitogen-induced cell cycle progression when abnormally or prematurely expressed. It is localized to the perinuclear region. Two alternatively spliced variants encoding the same isoform have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display chronic myelocytic leukemia in either the chronic phase or blast crisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Sipa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Sipa1 APN 19 5660978 start codon destroyed probably null 0.79
IGL01837:Sipa1 APN 19 5652071 missense probably damaging 0.98
IGL02858:Sipa1 APN 19 5655708 missense probably damaging 0.99
IGL03024:Sipa1 APN 19 5656161 missense probably damaging 1.00
R0277:Sipa1 UTSW 19 5654065 missense probably benign
R0831:Sipa1 UTSW 19 5660354 missense probably damaging 1.00
R0841:Sipa1 UTSW 19 5654807 missense probably benign 0.06
R1102:Sipa1 UTSW 19 5652754 missense probably benign
R1459:Sipa1 UTSW 19 5651664 missense probably damaging 1.00
R1460:Sipa1 UTSW 19 5651447 missense probably benign
R2422:Sipa1 UTSW 19 5652112 missense possibly damaging 0.47
R3741:Sipa1 UTSW 19 5654857 missense probably damaging 1.00
R3924:Sipa1 UTSW 19 5660379 missense probably benign 0.05
R4231:Sipa1 UTSW 19 5654089 missense probably damaging 1.00
R4525:Sipa1 UTSW 19 5651957 missense probably benign 0.12
R4721:Sipa1 UTSW 19 5660385 missense probably damaging 0.99
R5267:Sipa1 UTSW 19 5655758 missense probably benign 0.10
R5375:Sipa1 UTSW 19 5659612 missense probably damaging 0.99
R5480:Sipa1 UTSW 19 5659630 missense possibly damaging 0.68
R5582:Sipa1 UTSW 19 5654701 missense probably benign 0.00
R6005:Sipa1 UTSW 19 5656201 missense probably damaging 1.00
R6329:Sipa1 UTSW 19 5651489 missense probably damaging 1.00
R6712:Sipa1 UTSW 19 5660819 missense possibly damaging 0.69
R7209:Sipa1 UTSW 19 5654975 missense probably damaging 1.00
R7213:Sipa1 UTSW 19 5660523 missense probably damaging 1.00
R7665:Sipa1 UTSW 19 5651671 missense probably benign 0.00
R7881:Sipa1 UTSW 19 5651676 missense probably damaging 1.00
R7895:Sipa1 UTSW 19 5652662 missense probably benign
R7964:Sipa1 UTSW 19 5651676 missense probably damaging 1.00
R7978:Sipa1 UTSW 19 5652662 missense probably benign
X0057:Sipa1 UTSW 19 5654920 nonsense probably null
X0064:Sipa1 UTSW 19 5652736 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGGATCCTTCTCTCGGAAAGG -3'
(R):5'- TGGGATTACAGGCTCAGGAG -3'

Sequencing Primer
(F):5'- CTTCTCTCGGAAAGGCTGGAG -3'
(R):5'- TCAGGAGGCAGGTTTCCTC -3'
Posted On2016-07-06