Incidental Mutation 'R6084:Rock1'
ID 482429
Institutional Source Beutler Lab
Gene Symbol Rock1
Ensembl Gene ENSMUSG00000024290
Gene Name Rho-associated coiled-coil containing protein kinase 1
Synonyms 1110055K06Rik, Rock-I
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock # R6084 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 10064401-10181792 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10101007 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 636 (E636G)
Ref Sequence ENSEMBL: ENSMUSP00000069549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067947]
AlphaFold P70335
Predicted Effect probably benign
Transcript: ENSMUST00000067947
AA Change: E636G

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069549
Gene: ENSMUSG00000024290
AA Change: E636G

DomainStartEndE-ValueType
S_TKc 76 338 4.07e-97 SMART
S_TK_X 341 401 4.02e-9 SMART
low complexity region 408 419 N/A INTRINSIC
PDB:3O0Z|D 535 700 1e-101 PDB
low complexity region 715 731 N/A INTRINSIC
PDB:4L2W|B 832 914 7e-28 PDB
Pfam:Rho_Binding 948 1014 4.3e-26 PFAM
PH 1119 1319 1.19e-6 SMART
C1 1229 1283 2.64e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have open eyes at birth, omphalocele and most die soon after birth as a result of cannibalization by the mom. Survivors develop inflammation of the eyelid. Another homozygous mutant shows partial lethality around implantation and reduced cardiac fibrosis after pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Rock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Rock1 APN 18 10080502 missense probably benign 0.44
IGL01535:Rock1 APN 18 10132119 splice site probably benign
IGL01751:Rock1 APN 18 10079113 critical splice donor site probably null
IGL01752:Rock1 APN 18 10079113 critical splice donor site probably null
IGL02318:Rock1 APN 18 10104323 splice site probably benign
IGL02420:Rock1 APN 18 10070619 splice site probably null
IGL03030:Rock1 APN 18 10070215 splice site probably benign
IGL03339:Rock1 APN 18 10097493 missense probably benign 0.00
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0480:Rock1 UTSW 18 10079120 missense possibly damaging 0.92
R0538:Rock1 UTSW 18 10132227 missense possibly damaging 0.53
R0719:Rock1 UTSW 18 10099328 missense probably damaging 1.00
R1033:Rock1 UTSW 18 10067535 missense probably benign 0.12
R1448:Rock1 UTSW 18 10070233 missense probably damaging 1.00
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1694:Rock1 UTSW 18 10136094 critical splice donor site probably null
R1862:Rock1 UTSW 18 10079207 missense probably damaging 0.99
R1995:Rock1 UTSW 18 10101026 nonsense probably null
R2177:Rock1 UTSW 18 10070263 missense probably benign 0.18
R2892:Rock1 UTSW 18 10072863 nonsense probably null
R3780:Rock1 UTSW 18 10067575 missense probably benign 0.00
R3884:Rock1 UTSW 18 10122768 missense probably damaging 1.00
R4352:Rock1 UTSW 18 10079237 missense probably damaging 1.00
R4414:Rock1 UTSW 18 10080514 missense probably damaging 1.00
R4646:Rock1 UTSW 18 10112391 missense probably benign
R4694:Rock1 UTSW 18 10136152 nonsense probably null
R4888:Rock1 UTSW 18 10122698 missense probably benign 0.06
R5085:Rock1 UTSW 18 10140210 missense probably damaging 1.00
R5884:Rock1 UTSW 18 10099361 missense probably benign 0.03
R5927:Rock1 UTSW 18 10116792 missense probably damaging 1.00
R6151:Rock1 UTSW 18 10106426 missense possibly damaging 0.79
R6360:Rock1 UTSW 18 10116778 missense possibly damaging 0.52
R6892:Rock1 UTSW 18 10122612 missense probably benign 0.00
R7313:Rock1 UTSW 18 10129317 missense possibly damaging 0.73
R7397:Rock1 UTSW 18 10097599 missense possibly damaging 0.80
R7488:Rock1 UTSW 18 10122762 missense probably damaging 1.00
R7515:Rock1 UTSW 18 10067631 missense probably damaging 0.97
R7567:Rock1 UTSW 18 10090820 missense probably benign 0.35
R7569:Rock1 UTSW 18 10140194 missense probably damaging 1.00
R7639:Rock1 UTSW 18 10140244 missense probably damaging 1.00
R7836:Rock1 UTSW 18 10097651 splice site probably null
R7844:Rock1 UTSW 18 10104173 missense probably damaging 0.99
R7943:Rock1 UTSW 18 10112357 missense probably damaging 1.00
R7945:Rock1 UTSW 18 10116831 missense probably damaging 1.00
R8421:Rock1 UTSW 18 10072863 nonsense probably null
R8801:Rock1 UTSW 18 10070260 missense probably damaging 1.00
R8819:Rock1 UTSW 18 10070626 missense probably damaging 1.00
R9281:Rock1 UTSW 18 10080479 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCATACATACATTCCCATATACCAGG -3'
(R):5'- ATTTAAGAGGCTGTTTCTTCCTCTG -3'

Posted On 2017-07-14