Incidental Mutation 'R6084:Rap1b'
ID482408
Institutional Source Beutler Lab
Gene Symbol Rap1b
Ensembl Gene ENSMUSG00000052681
Gene NameRAS related protein 1b
Synonyms
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R6084 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location117813871-117846035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117824611 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 14 (V14I)
Ref Sequence ENSEMBL: ENSMUSP00000066238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064667]
Predicted Effect probably damaging
Transcript: ENSMUST00000064667
AA Change: V14I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066238
Gene: ENSMUSG00000052681
AA Change: V14I

DomainStartEndE-ValueType
RAS 1 168 2.4e-122 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and perinatal lethality, abdominal, cranial, and hepatic bleeding in mice that die in utero, reduced platelet aggregation, and decreased thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Rap1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Rap1b APN 10 117822860 missense probably damaging 1.00
IGL02539:Rap1b APN 10 117822804 missense possibly damaging 0.82
IGL03286:Rap1b APN 10 117818575 nonsense probably null
R0591:Rap1b UTSW 10 117818617 unclassified probably benign
R1939:Rap1b UTSW 10 117818586 missense probably damaging 1.00
R2509:Rap1b UTSW 10 117818539 missense probably damaging 0.98
R2902:Rap1b UTSW 10 117824602 missense probably damaging 1.00
R4825:Rap1b UTSW 10 117818582 missense probably benign 0.04
R5131:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6186:Rap1b UTSW 10 117820552 missense probably damaging 1.00
R6737:Rap1b UTSW 10 117822808 missense probably damaging 0.97
R7026:Rap1b UTSW 10 117818479 missense probably benign 0.01
R7530:Rap1b UTSW 10 117817452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGATCTTACCTTAATCAGACCAAG -3'
(R):5'- GCTCCCATGGGAATCTAGTC -3'

Posted On2017-07-14