Incidental Mutation 'R6075:Slc5a12'
ID482684
Institutional Source Beutler Lab
Gene Symbol Slc5a12
Ensembl Gene ENSMUSG00000041644
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 12
SynonymsSMCT2
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location110597298-110647779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110616747 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 200 (L200P)
Ref Sequence ENSEMBL: ENSMUSP00000106655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045972] [ENSMUST00000111026]
Predicted Effect probably damaging
Transcript: ENSMUST00000045972
AA Change: L200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047340
Gene: ENSMUSG00000041644
AA Change: L200P

DomainStartEndE-ValueType
Pfam:SSF 41 449 6.5e-43 PFAM
transmembrane domain 507 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111026
AA Change: L200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106655
Gene: ENSMUSG00000041644
AA Change: L200P

DomainStartEndE-ValueType
Pfam:SSF 41 445 6.2e-48 PFAM
transmembrane domain 503 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146664
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Normal blood lactate is maintained at about 1.5 mM, and little filtered lactate is excreted in urine. Reabsorption of lactate is mediated by the low-affinity Na(+)-coupled lactate transporter SLC5A12 in the initial part of the proximal tubule and by the high-affinity Na(+)-coupled lactate transporter SLC5A8 (MIM 608044) in the distal proximal tubule (Gopal et al., 2007 [PubMed 17692818]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Slc5a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc5a12 APN 2 110597822 missense probably damaging 1.00
IGL01337:Slc5a12 APN 2 110620373 nonsense probably null
IGL01830:Slc5a12 APN 2 110597806 missense probably damaging 1.00
IGL02456:Slc5a12 APN 2 110616834 splice site probably benign
IGL02619:Slc5a12 APN 2 110640856 missense probably benign 0.00
IGL02832:Slc5a12 APN 2 110640815 missense probably benign
IGL02890:Slc5a12 APN 2 110624133 splice site probably benign
IGL03058:Slc5a12 APN 2 110640792 missense probably benign 0.23
R0607:Slc5a12 UTSW 2 110632743 missense probably benign 0.30
R1342:Slc5a12 UTSW 2 110617090 splice site probably null
R1532:Slc5a12 UTSW 2 110610138 missense possibly damaging 0.64
R1992:Slc5a12 UTSW 2 110621744 missense probably benign 0.04
R2354:Slc5a12 UTSW 2 110609432 missense probably damaging 0.97
R3830:Slc5a12 UTSW 2 110632736 nonsense probably null
R4728:Slc5a12 UTSW 2 110644424 nonsense probably null
R4822:Slc5a12 UTSW 2 110621740 missense possibly damaging 0.90
R4937:Slc5a12 UTSW 2 110620408 missense probably damaging 1.00
R5860:Slc5a12 UTSW 2 110597624 missense probably benign 0.30
R6168:Slc5a12 UTSW 2 110616744 missense probably damaging 1.00
R6853:Slc5a12 UTSW 2 110624194 missense probably benign 0.37
R6870:Slc5a12 UTSW 2 110641810 missense probably damaging 0.99
R7014:Slc5a12 UTSW 2 110644364 missense probably benign 0.00
R7135:Slc5a12 UTSW 2 110616714 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGTCAGAATGAGTTCCCATGTG -3'
(R):5'- GTGCCGTCTTAGAGGATCTACATC -3'

Posted On2017-07-14